I. Mutations A change in the genetic code

Slides:



Advertisements
Similar presentations
Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring, only to descendant cells)
Advertisements

8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.
 Mutation – any change in DNA sequence  Can be caused by errors inside the cell ◦ Errors in  Replication  Transcription  Cell division (mitosis,
Chromosomes/DNA Mutations
MUTATIONS. Definition = A change in the DNA sequence of an organism that could: have no effect on the organism alter the product of a gene Prevent a gene.
Mutation and Genetic Change
Definition : Any change in the nucleotide sequence of DNA.
Gene Mutations Chapter 11.
Types of Mutations Graphic Organizer
Section 11.3 Genetic Changes.
1 NOTES: MUTATIONS 2 MUTATIONS: MUTATIONS = changes in the DNA sequence that affect genetic information.
DNA Mutations What is a gene mutation? Often times, parts of DNA will have a base (or more) missing, added, or incorrect Can be caused by: errors in.
Chromosomes and Genes Each chromosome has hundreds or thousands of genes. Each gene codes for a particular protein.
MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.
Gene Regulation. Regulatory genes Promoter: where RNA polymerase attaches. TATA box: a segment on eukaryotic genes that positions RNA polymerase in the.
Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)
Unit 6 Notes: Mutations. DNA Mutations Mutations: Any change in the sequence of nitrogenous bases of DNA. Causes: – Mutagens = factors that change chemical.
MUTATIONS! Part One. MUTATIONS: WHAT ARE THEY ? MUTATIONS: w are changes in the genetic material of the cell. w can occur at the level of an individual.
CHAPTER 14 SECTION 1 Mutations. Are mutations good or bad?  Some mutations lead to genetic disorders  Some mutations may cause a beneficial trait 
Mutation. What you need to know How alteration of chromosome number or structurally altered chromosomes can cause genetic disorders How point mutations.
Chromosomes/DNA Mutations. Chromosome Mutation Mutations are permanent gene or chromosome changes that will be passed on to offspring if they occur in.
DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.
A change in the nucleotide sequence of DNA Ultimate source of genetic diversity Gene vs. Chromosome.
Mutations: Definition: Changes in DNA in an organism. These changes can be problematic, can be helpful, or can have no effect. Mutations are what DRIVES.
Mutation Notes: Chapter 11.
12.4 Assessment Answers.
Mutations.
Gene Mutations.
Mutations.
11.3 Mutations.
Chapter 14 GENETIC VARIATION.
MUTATIONS.
A change in the DNA sequence that affects genetic information
Mutations.
Mutations.
Mutations Chapter 12-4.
Mermaid Syndrome Video.
Mutations.
Types of Mutations.
Gene Mutations Chapter 11.
Genetic Mutations.
Gene Mutations.
Gene Mutations Essential Question: How do changes in the DNA nucleotide sequence affect the resulting protein?
Sometimes replication, transcription and translation don’t go as planned! Replication, Transcription, and Translation errors result in mutations. A mutation.
Genetic Mutations.
Chromosomes/DNA Mutations
Mutations.
Mutations.
A change in the DNA sequence that affects genetic information
Mutations of nucleotide sequences and chromosome abnormalities
Mutations.
Chapter 13: Genes & Chromosomes
Mutations changes in the DNA sequence that can be inherited
Do Now What is the central dogma of biology?
Mutations.
Hydrogen bonds break (DNA polymerase)
Mutations Any change in an organism’s DNA. Mutations in somatic cells only impact individual; mutations in gametes may impact offspring. 2 Types: A. Gene.
Mutations.
Mutations A mutation is any change in the DNA sequence.
Mutations.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Genetic Mutations Karyotype: the number and visual appearance of the chromosomes in the cell nuclei of an organism or species.
Mutations A mutation is any change in the DNA sequence.
10th Grade Biology Mr. Walker
Genetic Mutations.
Mutation Notes.
Genes & Mutations Miss Richardson SBI4U.
C-Notes: Mutations Stnd: BI.4.c 10/23/13
Mutations Notes.
Presentation transcript:

I. Mutations A change in the genetic code Mutagen: substance that causes a mutation 3 Types: DNA Chromosome Non-DisJunction

1. DNA Mutation A. Point Mutation: change in a single base pair THE DOG BIT THE CAT THE DOG BIT THE CAR

B. Frameshift Mutation: 1. Single base is added or deleted 2. All other bases shift one spot THE DOG BIT THE CAT THE DGB ITT HEC AT? or THE DOR GBI TTH ECA How would this change the amino acid sequence? Need to know types of mutations. Silent mutation – change in DNA sequence but still codes for the same amino acid. Missense mutation – change in the DNA sequence changes a single amino acid. Nonsense – change in DNA sequence codes for a premature STOP sequence and the rest of the sequence is not translated

2. Chromosome Mutations: a. Change in the chromosome b. Chromosome: 5 – 10 % DNA 90 – 95% protein Need to know types of chromosome mutations (on next slide)

1. Deletion: portion missing c. 3 examples: 1. Deletion: portion missing 2. Inversion: portion inverted on chromosome 3. Translocation: portion moves to the other homologous chrom. Chapter 12.4

3. Non-Disjunction: a. Failure of chrom to separate properly during meiosis b. Incorrect number of chrom in egg/sperm c. Examples: Trisomy 21 (Down’s Syndrome)

http://images. google. com/images http://images.google.com/images?gbv=2&hl=en&q=non-disjunction+mutation

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2025 SlidePlayer.com. Inc. All rights reserved.