DNA: The Secret of Life By: James Watson Chapter 3: Reading the Code.

Slides:

Advertisements

Similar presentations

Chapter 1 overview 1.1DNA is the molecule of heredity “discovered” by Miesher (1869)

Advertisements

Lipids and Nucleic Acids Honors Biology Monkemeier2014.

THE MOLECULAR BASIS OF INHERITANCE. ANNOUNCEMENTS Second set of genetics problems has been posted!!

Intro to Molecular Genetics RNA & Protein Synthesis 3/16/2011.

DNA Transcription and Translation

Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis

SC.912.L.16.3 Describe the basic process of DNA replication and how it relates to the transmission and conservation of the genetic information.

1 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 25 Image Slides.

Chapter 13: RNA and Protein Synthesis

CHAPTER 12: GENETICS.

RNA and Protein Synthesis

DNA Structure & Function. Perspective They knew where genes were (Morgan) They knew what chromosomes were made of Proteins & nucleic acids They didn’t.

DNA, RNA, and Protein Synthesis Chapter 10 Section 1 Discovery of DNA Meischer Levene Griffith Avery Hershey and Chase Section 2 DNA Structure Section.

Date DNA. ✤ DNA stands for deoxyribonucleic acid ✤ DNA carries all the genetic information of living organisms.

Predicting protein degradation rates Karen Page. The central dogma DNA RNA protein Transcription Translation The expression of genetic information stored.

12.3 DNA, RNA, and Protein Objective: 6(C) Explain the purpose and process of transcription and translation using models of DNA and RNA.

Transcription and Translation How genes are expressed (a.k.a. How proteins are made) Biology.

Have your clickers ready!. 1. An amino acid. 2. A type of mutation 3. Three mRNA bases that code for an amino acid. 4. The genetic code. Countdown 30.

Ribosomes and Protein Synthesis. Learning Objectives  Identify the genetic code and explain how it is read.  Summarize the process of translation. 

Unit 4: Genetic Information, Variation and Relationships between Organisms Lesson 1 Genetic Organisation IN PROKARYOTIC CELLS, DNA MOLECULES ARE SHORT,

THE CONCEPT OF THE GENOME AS THE COMPLETE SET OF GENES IN A CELL AND OF THE PROTEOME AS THE FULL RANGE OF PROTEINS THAT A CELL IS ABLE TO PRODUCE. THE.

12.3 DNA, RNA, and Protein Molecular Genetics Central Dogma  RNA  Contains the sugar ribose and the base uracil  Usually is single stranded Chapter.

Chapter 13 Test Review.

WARM UP “Give what you have. To someone else, it may be better than you dare to think.” –Henry Wordsworth Longfellow 1.What does this quote mean to you?

DNA, RNA, & Protein Synthesis (12.3) State Standards 2A. Distinguish between DNA and RNA. 2B. Explain the role of DNA in storing and transmitting cellular.

Agenda for Monday, February 1, While You Are Waiting - #1 2.Check Your Homework 3.Translation Video Clip 4.Assignment: Ribosomes and Protein Synthesis.

SC.912.L.16.3 DNA Replication. – During DNA replication, a double-stranded DNA molecule divides into two single strands. New nucleotides bond to each.

DNA and proteins OBJECTIVES Explain the meaning of the term genetic code. Describe transcription.

From Gene to Protein: Transcription & RNA Processing

Section 3: DNA, RNA, and Protein

Part 5 Translation.

Variation among organisms

Unit 4: Genetic Information, Variation and Relationships between Organisms Lesson 2 The Triplet Code A sequence of three DNA bases, called a triplet,

 The human genome contains approximately genes.  At any given moment, each of our cells has some combination of these genes turned on & others.

From DNA to Proteins Transcription.

Protein Synthesis.

DNA and Heredity Why do children “look” like their biological parents?

Genes and How they Work Chapter 15.

Gene Expression Continued

DNA Test Review.

Central Dogma of Molecular Biology From Genes to Protein

BIOLOGY Vocabulary Chapter 12 & 13.

From Gene to Protein: Transcription & RNA Processing

From Gene to Protein.

Isolating DNA from Bacterial Cells.

Transfer of information from DNA

Activity #42: DNA STRUCTURE

Protein synthesis: Overview

Chapter 17 Hon. Adv. Biology Notes 12/01/06

Lesson 1: Evolution.

Isolating DNA from Bacterial Cells.

DNA Basics What do you know about DNA?

Transcription and Translation

Chapter 6 Bellringer Unscramble the following words: tpsoneir neesg

DNA: The Secret of Life By: James Watson

Genetics Lesson 3.

Have your clickers ready!

Genetics Transcription & Translation.

DNA in the Genomic era.

Continuation: translation

Title: Biology 4/13/07 Objectives: Class Topics

Title: Biology 4/10/07 Objectives: Class Topics

Chapter 10 – The Gene and Protein Synthesis

DNA Transcription and Translation

DNA: The Secret of Life By: James Watson

Presentation transcript:

DNA: The Secret of Life By: James Watson Chapter 3: Reading the Code

DNA: The Secret of Life Reading Reflection Chapters 3 Central Dogma of Biology Genetic Code Gene Expression

Mutations

Reading Reflection Given the DNA sequence below find the mRNA sequence and the polypeptide sequence. …. TACCCGGCGGGCCTAATACCG… What are the possible ramifications of changing one of the bases in this sequence? Describe the relationship between structure and function in proteins (applies to all molecules)? Pick one researcher/group of researchers that contributed to our understanding of how DNA works… Describe their work, what was their major discovery?, how did it help other researchers working on DNA? (Bonus) Place the collective works of the scientists in Chapter 3 on the Nature vs. Nurture spectrum.