Protein Synthesis Living Environment

Review What are proteins? Chains of Amino Acids connected to one another by peptide bonds. Have a specific shape and function. Examples: Enzymes Hormones Antibodies Hemoglobin Review

What is the difference between DNA & RNA?

What is Protein Synthesis ? The process of making proteins. Proteins make up everything in our bodies and control our physical characteristics. Example(s): proteins, enzymes, hormones, antibodies, and hemoglobin. What is Protein Synthesis ?

The building blocks of proteins: Amino Acids Protein function is determined by the shape and order/sequence of Amino Acids. The building blocks…

DNA’s job in protein synthesis… DNA’s job is to code for (make) a protein. DNA contains the instructions for making all proteins. Each gene in the DNA will code for a protein. ***** The order for the nitrogen bases in a strand of DNA will determine the Amino Acids order*** DNA’s job in protein synthesis…

Protein Synthesis contains 3 steps… 1. Transcription (in the nucleus) 2. mRNA strand leaves the nucleus 3. Translation (out of the nucleus)

1. Transcription (in the nucleus) The first step… This is when the DNA molecule “unzips” and a strand of mRNA is created. ***This happens in the nucleus!*** A  U T  A C  G G  C Example: DNA: T G C C G A A T C G A T mRNA: A C G G C U U A G C U T 1. Transcription (in the nucleus)

Transcription

Transcription practice… DNA: ATC GCA AGC TAT RNA: DNA: TAC TGG CGA ATC Transcription practice…

The mRNA (messenger RNA ) leaves the nucleus and goes to the ribosomes. Step 2

Step 3 Translation (out of the nucleus) The mRNA acts as a code that tells the tRNA which Amino Acids to bring over. Codon: set of three Nitrogen bases Each codon “codes for” one Amino Acid Step 3 Translation (out of the nucleus)

Circle the codon!

DNA original template strand: T G C C G A A T C G A T mRNA strand: A C G G C U U A G C U A mRNA broken up into codons: ACG/GCU/UAG/CUA

Write out the amino acids... mRNA broken up into codons: ACG/GCU/UAG/CUA Amino Acids: HOW? Write out the amino acids...

How do we read this chart? Steps: Use the left side to find the first letter in the codon. Use the top to find the second letter in the codon. Use the right side to find the third letter of the codon. Find where they match up. How do we read this chart?

What are start and stop codons? Start Codon: The first codon in the transcribed mRNA that undergoes translation Stop Codon: These codons signal the end of the polypeptide chain during translation. What are start and stop codons?

Lets practice… mRNA broken up into codons: ACG/GCU/UAG/CUA Amino Acids: Lets practice… THR/ ALA/ STOP/ LEU

Example:

Overall…

Demo DNA template strand: GAGTGTGTTGAACGATGCTCTACTCATCGTTGGGTT mRNA: CUCACACAACUUGCUACGAGAUGAGUAGCAACCCAA Codon: LEU/THR/GLN/LEU/ALA/THR/ARG/STOP/VAL/ALA/THR/ ILE Demo