Study Guide: Cell Cycle, DNA Replication, and Mitosis
List the phases of the cell cycle in order List the phases of the cell cycle in order. Draw a picture that represents the cell cycle. G1, S, G2, M
List the phases of mitosis in order. Draw each phase of mitosis. prophase, metaphase, anaphase, telophase List the phases of mitosis in order. Draw each phase of mitosis.
Explain what happens in prophase, metaphase, anaphase and telophase. Prophase- centrioles move to poles; spindle forms; nucleus breaks down; chromosomes become visible Metaphase- chromosomes line up at the equatorial plate Anaphase - centromeres split and chromatids separate; they move along spindle to opposite poles Telophase - two identical groups of chromosomes gather at opposite poles of the cell ; spindle breaks down; chromosomes spread out into chromatin; new nuclear membranes forms
Define mitosis. process of division of the nucleus in eukaryotic cells
What happens in each of the phases of the cell cycle? G1 - cell growth S - DNA is duplicated G2 - preparation for mitosis M - mitosis and cytokinesis
What is a centromere? Centriole? Draw and label a picture of each. Centromere—connects sister chromatids in a duplicated chromosome Centriole—radiates the spindle
Which phases of the cell cycle occur during interphase? G1, S, G2
Cells formed during mitosis are called __________________. DAUGHTER CELLS
During which stage of mitosis do the chromosomes first appear? PROPHASE
During which phase of mitosis do chromosomes line up in the middle of the cell? METAPHASE
How do plant cells perform cytokinesis? FORM A new CELL WALL
How do animal cells perform cytokinesis? THE CELL MEMBRANE PINCHES IN
Why do cells undergo cell division? GROWTH, REPAIR, & REPLACEMENT
What is the role of the spindle during mitosis? PULLS CHROMOSOMES TO OPPOSITE SIDES OF THE CELL
What happens after mitosis is complete? THE CELLS ENTER INTO INTERPHASE AND THE PROCESS STARTS AGAIN
What is a duplicated chromosome made up of? 2 SISTER CHROMATIDS
After the process of mitosis occurs, each daughter cell receives an exact copy of the parent cell DNA.
If the sequence of bases on one strand of a DNA molecule is ATTGCCCATG, then what will be the sequence on the complementary DNA strand? TAACGGGTAC
In a portion of a gene, the base sequence is T-C-G-A-A-T In a portion of a gene, the base sequence is T-C-G-A-A-T. Which complementary base sequence would be found bonded to this section of the gene? A-G-C-T-T-A
What role do DNA helicases have in DNA replication What role do DNA helicases have in DNA replication? Unzip the DNA molecule.
DNA replication results in 2 DNA molecules DNA replication results in 2 DNA molecules. How many strands of each are new and how many of each are original? One old & one new strand
During the process shown above, the 2 strands of 1 DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results in the formation of 2 identical DNA molecules. What is this process known as? DNA REPLICATION
Using the following, determine the complementary strand: DNA TACCATTCCGATACCAAGACC Comp DNA: ATGGTAAGGCTATGGTTCTGG