Fig. 2. Increased CD19 CAR-T cell expansion and persistence after Cy/Flu lymphodepletion. Increased CD19 CAR-T cell expansion and persistence after Cy/Flu.

Slides:

Advertisements

Similar presentations

T Cells with Chimeric Antigen Receptors Have Potent Antitumor Effects and Can Establish Memory in Patients with Advanced Leukemia by Michael Kalos, Bruce.

Advertisements

Professor John Gribben Barts Cancer Institute

Fig. 1. TP is highly expressed in myeloma.

LTB4 production is elevated in preclinical and clinical lymphedema

Fig. 5. Blocking LTB4 during initial lymphangiogenesis period abrogates the therapeutic benefit of LTB4 antagonism. Blocking LTB4 during initial lymphangiogenesis.

Fig. 5. Correlation between CD34+CD45RA−CD90+ cell dose, engraftment success, and onset of neutrophil/platelet recovery in nonhuman primates. Correlation.

Therapeutic levels of fetal hemoglobin in erythroid progeny of β-thalassemic CD34+ cells after lentiviral vector-mediated gene transfer by Andrew Wilber,

Fig. 1. Anemia in patients with central diabetes insipidus.

Fig. 2 miRNA181a targets NFAT5 in human CD4+ T cells.

Fig. 2. Engraftment of CART-EGFRvIII and cytokine modulation in the peripheral blood. Engraftment of CART-EGFRvIII and cytokine modulation in the peripheral.

Fig. 2 TLR8 is aberrantly expressed on pDCs from SSc patients.

CD20-specific adoptive immunotherapy for lymphoma using a chimeric antigen receptor with both CD28 and 4-1BB domains: pilot clinical trial results by Brian.

Adoptive Therapy with T Cells/NK Cells

Fig. 1 pDCs infiltrate the skin of SSc patients and spontaneously secrete IFN-α and CXCL4. pDCs infiltrate the skin of SSc patients and spontaneously secrete.

Fig. 8. mRIPO elicits neutrophil influx followed by DC and T cell infiltration into tumors. mRIPO elicits neutrophil influx followed by DC and T cell infiltration.

Fig. 7. The PD-L1 defect is evident in HSPCs from T1D patients.

CAR8 failure in an OT1 TCR transgenic T cell after exposure to OVA

Intravenous delivery of reovirus to primary and secondary brain tumors

Fig. 2. GPC3 expression in normal and tumor tissues.

Fig. 5. Immunohistochemistry of the tumor microenvironment in GBM specimens before and after CART-EGFRvIII infusion. Immunohistochemistry of the tumor.

Expression of CD36 and psap in a TMA of human ovarian cancer patients

Fig. 4. Specific versus nonspecific NP accumulation.

Fig. 5. Vascularization of human liver seed grafts.

Fig. 7 Gel scaffold for inhibition of postsurgical recurrence of B16F10 tumors. Gel scaffold for inhibition of postsurgical recurrence of B16F10 tumors.

A atgaagacagtgactggacctttgttcctgtgcttctggctgcagctgaactgtgtgagcagaggcgagcaggtggagcagcgccctcctcacctgagtgtccgggagggagacagtgccgttatcatctgcacctacacagaccctaacagttattacttcttctggtacaagcaagagccgggggcaggtcttcagttgcttatgaaggttttctcaagtacggaaataaacgaaggacaaggattcactg

Fig. 4. MATE1 transcription in RCC.

Fig. 2. Best model fits. Best model fits. Illustration of the best model fits for the (A) basic, (B) continuous, and (C) cluster models. See Table 1 and.

Fig. 2 Stroke increases vascular inflammation via recruitment of inflammatory monocytes to atherosclerotic plaques. Stroke increases vascular inflammation.

Fig. 3 In situ vaccination with CpG and anti-OX40 is therapeutic in a spontaneous tumor model. In situ vaccination with CpG and anti-OX40 is therapeutic.

Fig. 3 Liver stiffness and NT-proBNP concentration after treatment with miridesap followed by dezamizumab. Liver stiffness and NT-proBNP concentration.

Fig. 1. Experimental workflow of the dAST method and computationally estimated operational space. Experimental workflow of the dAST method and computationally.

Persistence of CAR4 cells is reduced after sustained TCR engagement

Fig. 4. Restriction of TCR antigen to hematopoietic tissues does not prevent CAR8 exhaustion and failure of leukemia clearance. Restriction of TCR antigen.

Fig. 7 BRD0705 impairs colony formation in AML cell lines and patient cells and shows in vivo efficacy in multiple AML mouse models. BRD0705 impairs colony.

Antiproliferative effects of JQ-EZ-05 on VHL−/− ccRCC are on-target

Fig. 3. Recovery of AVP-deficient rats from anemia induced by sublethal irradiation. Recovery of AVP-deficient rats from anemia induced by sublethal irradiation.

Fig. 5 CXCL4 potentiates TLR9-mediated activation but has minimal effect on TLR7-mediated activation of pDCs purified from SSc or HDs. CXCL4 potentiates.

Fig. 5 Local gel scaffold for T cell memory response.

Fig. 1 HIV transcription profiles in freshly isolated CD4+ T cells and PBMCs from HIV-infected patients on ART suggest blocks to HIV transcriptional elongation,

Fig. 4 PD-L1 expression is found in the spleen and the BM of mice transplanted with JAK2V617F-transduced bone marrow. PD-L1 expression is found in the.

Volume 23, Issue 1, Pages (January 2015)

Fig. 2 Genotype-induced differential gene expression is different in MDMi cells compared to monocytes. Genotype-induced differential gene expression is.

Fig. 6. Analysis of SHIV-325c V1V2 envelope sequences in breakthrough infections. Analysis of SHIV-325c V1V2 envelope sequences in breakthrough infections.

Fig. 2. Exposure of both TCR and CAR antigens diminishes efficacy of CAR8 but not CAR4 cells. Exposure of both TCR and CAR antigens diminishes efficacy.

CD facilitates RCT in vivo and promotes urinary cholesterol excretion

Bexarotene is neuroprotective in mouse and human HD neurons in vitro

Fig. 5. Mapping of HBV S transcripts from HBeAg-positive and HBeAg-negative chimpanzees. Mapping of HBV S transcripts from HBeAg-positive and HBeAg-negative.

Evaluation of clinical responses after infusion of CART19 cells

Fig. 5. Prophylactic and therapeutic efficacy of C12G6 in ferrets.

Fig. 3 CSF1 is expressed in human melanoma.

Fig. 2. Efficient HDR in primary T cells leading to introduction of a GFP expression cassette within the CCR5 locus. Efficient HDR in primary T cells leading.

Fig. 2 Activation of freshly isolated CD4+ T cells from HIV-infected patients on ART results in successive increases in elongated, polyadenylated, and.

Fig. 5 BRD0705 induces differentiation in AML cell lines and primary patient samples through GSK3α-selective inhibition. BRD0705 induces differentiation.

Fig. 6 DMF inhibits NF-κB translocation upon infection.

Fig. 3 Activation of freshly isolated CD4+ T cells from HIV-infected patients on ART selectively reverses baseline blocks to splicing, elongation, and.

Fig. 4. Clearance of 12-mer-1 from a nonhuman primate model.

Correlation of reovirus RNA/protein with proliferating tumor cells

Fig. 7 Transient immunosuppression (4 weeks) supports long-term graft survival and is associated with progressive decrease in spinal regional inflammatory.

Fig. 2. CD treatment facilitates regression of murine atherosclerosis.

Fig. 3. The effect of VRC01 infusion on virus load in plasma and blood CD4 T cells during ART. The effect of VRC01 infusion on virus load in plasma and.

Fig. 3. Improved clinical responses to CD19 CAR-T cell immunotherapy after Cy/Flu lymphodepletion. Improved clinical responses to CD19 CAR-T cell immunotherapy.

Fig. 3. Increased expression of exhaustion markers and apoptosis markers on CAR8 cells in the presence of TCR antigen. Increased expression of exhaustion.

Fig. 1. DEL-1 is expressed by human and mouse osteoclasts.

Fig. 4. Long-term persistence of CTL019 cells and polyfunctionality in patients achieving CR. Long-term persistence of CTL019 cells and polyfunctionality.

Fig. 4 PD-L1 expression is found in the spleen and the BM of mice transplanted with JAK2V617F-transduced bone marrow. PD-L1 expression is found in the.

Evaluation of clinical responses after infusion of CART19 cells

Chimeric antigen receptor T cells persist and induce sustained remissions in relapsed refractory chronic lymphocytic leukemia by David L. Porter, Wei-Ting.

T Cells with Chimeric Antigen Receptors Have Potent Antitumor Effects and Can Establish Memory in Patients with Advanced Leukemia by Michael Kalos, Bruce.

Fig. 3. Association between peak CTL019 expansion and response.

Systemic inflammation in patients with severe neurotoxicity (NTX).

Presentation transcript:

Fig. 2. Increased CD19 CAR-T cell expansion and persistence after Cy/Flu lymphodepletion. Increased CD19 CAR-T cell expansion and persistence after Cy/Flu lymphodepletion. (A and B) Peak CD4+/EGFRt+ (A) and CD8+/EGFRt+ (B) CAR-T cell numbers after the first CAR-T cell infusion in relation to the percentage of CD19+ cells (normal and malignant CD19+ B cells) in the bone marrow before lymphodepletion chemotherapy for each patient. (C) CAR-T cell persistence in the blood as integrated transgene copies per microgram of DNA in two patients who received a cycle of Cy or Cy/E lymphodepletion chemotherapy and CAR-T cell infusion followed by a second cycle of Cy lymphodepletion chemotherapy and CAR-T cell infusion. Integrated transgene copies were determined by quantitative real-time fluorescence polymerase chain reaction (QPCR) for distinct sequences located in the Woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) or Flap/EF1α regions of the lentivirus. (D and E) Mean ± SEM of CD4+/EGFRt+ (D) and CD8+/EGFRt+ (E) CAR-T cell counts in the blood on the indicated days after CAR-T cell infusion for patients treated with 2 × 107 EGFRt+ cells/kg after either Cy or Cy/E lymphodepletion (No Flu) or Cy/Flu lymphodepletion (Cy/Flu). (F) CAR-T cell persistence in blood of patients who received Cy or Cy/E lymphodepletion (No Flu, black; n = 9) compared to Cy/Flu lymphodepletion (red; n = 18) is shown as FlapEF1α integrated transgene copies per microgram of DNA. CAR-T cell persistence data are truncated at the time of HCT for patients who underwent autologous or allogeneic HCT after CAR-T cell infusion. Cameron J. Turtle et al., Sci Transl Med 2016;8:355ra116 Published by AAAS