Katsuhito Kino, Hiroshi Sugiyama Chemistry & Biology

Slides:

Advertisements

Similar presentations

Lecture 1 Problem: From an E. coli cell extract, you assay enzyme activity for beta-galactosidase. You divide the extract into two samples, one of which.

Advertisements

Polymerase Chain Reaction (PCR)

Sequencing Using DNA dependant DNA polymerase Initiation & elongation commences Denature & anneal labelled primer * * dCTP dGTP dATP dTTPdCTP dATP dTTPdATP.

Principles of DNA Sequencing Terry Kotrla, MS, MT(ASCP)BB Spring 2010.

COMPUTER EXERCISE Design of PCR and PCR-RFLP experiments This presentation shows all steps of a PCR-RFLP experiment and is a companion of the computer.

Figure 30-2Autoradiogram and its interpretive drawing of a replicating E. coli chromosome. Page H-thymidine.

PCR Basics 1.Purpose of PCR 2.Overview 3.Components of PCR Reaction 4.Variables Temperature Cycle Times and Numbers Primer Buffer Polymerase 5.Experimental.

DNTP Imbalance in Mitochondria Alexandra Frolova Dr. Christopher K. Mathews Laboratory Biochemistry and Biophysics.

PCR Polymerase Chain Reaction. PCR - a method for amplifying (copying) small amount of DNA in nearly any amount required, starting with a small initial.

Sanger-Coulson Dideoxynucleotide Sequencing Kwamina Bentsi-Barnes Deisy Mendoza Jennifer Aoki Lecture 10/30/00 Best printed in color for clarity.

1.) DNA Extraction Follow Kit Grind sample Mix with solution and spin Bind, Wash, Elute.

DNA sequencing: Importance Basic blueprint for life; Aesthetics. Gene and protein. –Function –Structure –Evolution Genome-based diseases- “inborn errors.

(b) Separation of strands

Polymerase Chain Reaction (PCR) Developed in 1983 by Kary Mullis Major breakthrough in Molecular Biology Allows for the amplification of specific DNA fragments.

Nucleotides and Nucleic Acids. Cellular Processes DNA RNA (mRNA) Proteins LipidsCarbohydrates replication transcription translation.

Nucleic acid labeling Radioactive deoxynucleoside triphosphate (dNTP); labeled with H 3 (tritium) or P 32.dNTP Purposes: 1. keep tracking small amounts.

The Polymerase Chain Reaction (PCR)

Figure S1 RNA-primed DNA synthesis by T7 DNA polymerase. DNA synthesis on an M13 ssDNA template catalyzed by T7 DNA polymerase requires primers annealed.

Lecture 4: Polymerase Chain Reaction (PCR)

Lecturer: Bahiya Osrah Background PCR (Polymerase Chain Reaction) is a molecular biological technique that is used to amplify specific.

Presented by: Khadija Balubaid.  PCR (Polymerase Chain Reaction) is a molecular biological technique  used to amplify specific fragment of DNA in vitro.

The stroke size should be 0.25

DNA sequencing DNA sequencing is the process of determining the precise order of nucleotides within a DNA molecule. It includes any method or technology.

PCR Basics Purpose of PCR Overview Components of PCR Reaction

DNA Sequencing BCH 446.

Polymerase Chain Reaction (PCR)

Molecular Approaches for Screening of Genetic Diseases

Di-deoxynucleotide Chain Termination

From: Calcium-driven DNA synthesis by a high-fidelity DNA polymerase

Volume 4, Issue 2, Pages (August 1999)

Sequencing Technologies

Polymerase Chain Reaction (PCR)

DNA Sequence Determination (Sanger)

RNA aptamers as pathway-specific MAP kinase inhibitors

The DNA Polymerase III Holoenzyme

Nicolas Z. Rudinger, Ramon Kranaster, Andreas Marx Chemistry & Biology

Volume 68, Issue 2, Pages e3 (October 2017)

Oxidative Charge Transport through DNA in Nucleosome Core Particles

5. DNA Sequencing pp

Recognition of Major DNA Adducts of Enantiomeric Cisplatin Analogs by HMG Box Proteins and Nucleotide Excision Repair of These Adducts Jaroslav Malina,

Molecular Biology lecture -Putnoky

Volume 11, Issue 9, Pages (September 2004)

Volume 11, Issue 1, Pages (January 2004)

Huifang Huang, Stephen C Harrison, Gregory L Verdine

Bacteriophage T4 Proteins Replicate Plasmids with a Preformed R Loop at the T4 ori(uvsY) Replication Origin In Vitro Nancy G Nossal, Kathleen C Dudas,

Volume 139, Issue 5, Pages (November 2009)

Error-promoting DNA synthesis in ovarian cancer cells

Highly Efficient Self-Replicating RNA Enzymes

Sequence Diversity, Metal Specificity, and Catalytic Proficiency of Metal-Dependent Phosphorylating DNA Enzymes Wei Wang, Lieven P Billen, Yingfu Li

Reconstitution of the B

Interaction with PCNA Is Essential for Yeast DNA Polymerase η Function

Olga Rechkoblit, James C. Delaney, John M. Essigmann, Dinshaw J. Patel

In Search of an RNA Replicase Ribozyme

RNA-Catalyzed Thioester Synthesis

GnRH Binding RNA and DNA Spiegelmers

Ryan C. Wilson, Meghan A. Jackson, Janice D. Pata Structure

M.Todd Washington, Louise Prakash, Satya Prakash Cell

Sequence Diversity, Metal Specificity, and Catalytic Proficiency of Metal-Dependent Phosphorylating DNA Enzymes Wei Wang, Lieven P Billen, Yingfu Li

Sequence-Universal Recognition of Duplex DNA by Oligonucleotides via Pseudocomplementarity and Helix Invasion Irina V Smolina, Vadim V Demidov Chemistry.

Frpo: A Novel Single-Stranded DNA Promoter for Transcription and for Primer RNA Synthesis of DNA Replication Hisao Masai, Ken-ichi Arai Cell Volume.

Volume 12, Issue 1, Pages (January 2005)

Structural Insight into Translesion Synthesis by DNA Pol II

Helicase and Polymerase Move Together Close to the Fork Junction and Copy DNA in One-Nucleotide Steps Manjula Pandey, Smita S. Patel Cell Reports Volume.

Structural Insight into Translesion Synthesis by DNA Pol II

DNA Synthesis across an Abasic Lesion by Human DNA Polymerase ι

Volume 13, Issue 4, Pages (April 2006)

Kiyohiko Kawai, Yasuko Osakada, Mamoru Fujitsuka, Tetsuro Majima

SBI4U0 Biotechnology.

A Mechanism of AZT Resistance

Suppression of DNA-Mediated Charge Transport by BamHI Binding

Presentation transcript:

Possible cause of G·C→C·G transversion mutation by guanine oxidation product, imidazolone Katsuhito Kino, Hiroshi Sugiyama Chemistry & Biology Volume 8, Issue 4, Pages 369-378 (April 2001) DOI: 10.1016/S1074-5521(01)00019-9

Fig. 1 Oxidative products of guanine and proposed scheme for G·C→T·A and G·C→C·G transversion mutations caused by 8-oxoG and Iz, respectively. Chemistry & Biology 2001 8, 369-378DOI: (10.1016/S1074-5521(01)00019-9)

Fig. 2 HPLC analysis (254 nm) of photooxidation of 5′-AAAAAAGGAAAAAA-3′/5′-TTTTTTCCTTTTTT-3′ with photosensitizer, riboflavin after (a) 10 and (b) 60 min photoirradiation. Quantitative analysis of the enzymatic digestion of reaction mixture with (c) riboflavin or (d) AQ. Oxidized oligomer was digested with nuclease P1 and alkaline phosphatase. The amount of deoxyguanosine (black circles), 8-oxoG (open circles) and Iz (black squares) are shown after incubation periods of 0, 2, 5, 10, 20 30 and 60 min. Chemistry & Biology 2001 8, 369-378DOI: (10.1016/S1074-5521(01)00019-9)

Fig. 3 Photooxidation of AQ-linked oligomer, 5′-AQ-d(TTTTTTCTTTTTT), with complementary strand, 5′-d(AAAAAA8OGAAAAAA). HPLC analysis (254 nm) of enzymatic digestion mixture after (a) no and (b) 2 min of irradiation. Chemistry & Biology 2001 8, 369-378DOI: (10.1016/S1074-5521(01)00019-9)

Fig. 4 Electrostatic populations and energies of (a) proposed Iz·G and (b) Watson–Crick C·G base pairs. Chemistry & Biology 2001 8, 369-378DOI: (10.1016/S1074-5521(01)00019-9)

Fig. 5 Primer extension assay to identify nucleotides opposite Iz incorporated by pol I. (a) Sequences of template and primer were 5′-d(CCCAXTTCAAAATC)-3′ and 5′-Texas red-d(GATTTTGAA)-3′, respectively. (b) Concentration of triphosphate was 0.8 μM (final) and the amount of pol I was 0.5 U. Lanes 1, 3, 5, 7 and 9, template 1 (X=C); lanes 2, 4, 6, 8 and 10, template 2 (X=Iz); lanes 11 and 13, template 3 (X=T); lanes 12 and 14, template 4 (X=8-oxoG). Lanes 1 and 2, dCTP; lanes 3 and 4, dGTP; lanes 5 and 6, dTTP; lanes 7 and 8, dATP; lanes 9 and 10, dGTP and dTTP; lanes 11 and 12, dATP; lanes 13 and 14, dGTP, dTTP and dATP. Chemistry & Biology 2001 8, 369-378DOI: (10.1016/S1074-5521(01)00019-9)

Fig. 6 Primer extension assay to incorporate dIzTP opposite G using Kf. (a) Sequence of template is 5′-d(TTTGCTAGCCTTTTGCTCACATGTTATTTTCTGCGTTATCCCCTGATTCT)-3′ and that of primer is 5′-Texas red-d(AGAATCAGGGGATAACGCAG)-3′. (b) Sequencing by the Sanger method. The amount of Kf was 0.5 U. Lanes: 1, four normal dNTP (0.88 μM each); 2, dGTP, dTTP and dATP (0.88 μM each); 3, dIzTP (27 μM), dGTP, dTTP and dATP (0.88 μM each); 4, dIzTP (27 μM), dCTP reaction (11 nM), dGTP, dTTP and dATP (0.88 μM each); 5, reaction mixture of lane 4 heated with piperidine (1 M, 90°C, 20 min). Chemistry & Biology 2001 8, 369-378DOI: (10.1016/S1074-5521(01)00019-9)

Chemistry & Biology 2001 8, 369-378DOI: (10 Chemistry & Biology 2001 8, 369-378DOI: (10.1016/S1074-5521(01)00019-9)