Identification of Transglutaminase 3 Splicing Isoforms

Slides:

Advertisements

Similar presentations

Michael F. Naso, Bailin Liang, C

Advertisements

A Novel XPA Gene Mutation and its Functional Analysis in a Japanese Patient with Xeroderma Pigmentosum Group A Miki Tanioka, Arief Budiyant, Takahiro.

Epidermolysis Bullosa: Novel and De Novo Premature Termination Codon and Deletion Mutations in the Plectin Gene Predict Late-Onset Muscular Dystrophy

A PLEC Isoform Identified in Skin, Muscle, and Heart

Crucial Roles of MZF1 and Sp1 in the Transcriptional Regulation of the Peptidylarginine Deiminase Type I Gene (PADI1) in Human Keratinocytes Sijun Dong,

Transglutaminase 3 Protects against Photodamage

Skin-Specific Expression of ank-393, a Novel Ankyrin-3 Splice Variant

Modification of Alternative Splicing of Mcl-1 Pre-mRNA Using Antisense Morpholino Oligonucleotides Induces Apoptosis in Basal Cell Carcinoma Cells Jeng-Jer.

Expression of Transglutaminase 5 in Normal and Pathologic Human Epidermis Eleonora Candi, Sergio Oddi, Andrea Paradisi, Alessandro Terrinoni, Marco Ranalli,

Inactive and Highly Active, Proteolytically Processed Transglutaminase-5 in Epithelial Cells Valentina Pietroni, Sabrina Di Giorgi, Andrea Paradisi,

Identification and Characterization of ALK Kinase Splicing Isoforms in Non–Small-Cell Lung Cancer Lorena Lobo de Figueiredo-Pontes, MD, PhD, Daisy Wing-Sze.

Eija Siintola, Meral Topcu, Nina Aula, Hannes Lohi, Berge A

IFN-γ Upregulates Expression of the Mouse Complement C1rA Gene in Keratinocytes via IFN-Regulatory Factor-1 Sung June Byun, Ik-Soo Jeon, Hyangkyu Lee,

Transglutaminase 3 Protects against Photodamage

A PLEC Isoform Identified in Skin, Muscle, and Heart

Correction of Recessive Dystrophic Epidermolysis Bullosa by Transposon-Mediated Integration of COL7A1 in Transplantable Patient-Derived Primary Keratinocytes

The gap junction protein connexin43 interacts with the second PDZ domain of the zona occludens-1 protein Ben N.G. Giepmans, Wouter H. Moolenaar Current.

Retinoic Acid Inhibits Downregulation of ΔNp63α Expression During Terminal Differentiation of Human Primary Keratinocytes Casimir Bamberger, Hartwig.

Rose-Anne Romano, Barbara Birkaya, Satrajit Sinha

Daisuke Suzuki, Makoto Senoo Journal of Investigative Dermatology

Toshiyuki Ozawa, Daisuke Tsuruta, Jonathan C. R

Expression of Multiple Cytochrome P450 Enzymes and Multidrug Resistance- Associated Transport Proteins in Human Skin Keratinocytes Jens M. Baron, Daniela.

Psoriasis Upregulated Phorbolin-1 Shares Structural but not Functional Similarity to the mRNA-Editing Protein Apobec-1 Peder Madsen, Julio E. Celis,

Constitutive Overexpression of Human Telomerase Reverse Transcriptase but Not c- myc Blocks Terminal Differentiation In Human HaCaT Skin Keratinocytes

Enhancing 1α-Hydroxylase Activity with the 25-Hydroxyvitamin D-1α-Hydroxylase Gene in Cultured Human Keratinocytes and Mouse Skin Tai C. Chen, Xue Hong.

Transcriptional Control of the Mouse Col7a1 Gene in Keratinocytes: Basal and Transforming Growth Factor-β Regulated Expression Michael Naso, Jouni Uitto,

Molecular Cloning and Expression of Human Keratinocyte Proline-Rich Protein (hKPRP), an Epidermal Marker Isolated from Calcium-Induced Differentiating.

Tomoyasu Hattori, Lukasz Stawski, Sashidhar S

Yin-Yang 1 Negatively Regulates the Differentiation-Specific Transcription of Mouse Loricrin Gene in Undifferentiated Keratinocytes Xuezhu Xu, Yasuhiro.

Naohito Hatta, Craig Dixon, Amanda J. Ray, Sion R. Phillips, William J

Proteolytic Activation Cascade of the Netherton Syndrome–Defective Protein, LEKTI, in the Epidermis: Implications for Skin Homeostasis Paola Fortugno,

Neurofibromatosis Type 1 Protein and Amyloid Precursor Protein Interact in Normal Human Melanocytes and Colocalize with Melanosomes Sofie De Schepper,

Cryptic Splicing at a Non-Consensus Splice-Donor in a Patient with a Novel Mutation in the Plakophilin-1 Gene Peter M. Steijlen, Maurice A.M. van Steensel,

Identification of COL7A1 Alternative Splicing Inserting 9 Amino Acid Residues Into the Fibronectin Type III Linker Domain Daisuke Sawamura, Maki Goto,

MiR-125b, a MicroRNA Downregulated in Psoriasis, Modulates Keratinocyte Proliferation by Targeting FGFR2 Ning Xu, Petter Brodin, Tianling Wei, Florian.

A Homozygous Nonsense Mutation in Type XVII Collagen Gene (COL17A1) Uncovers an Alternatively Spliced mRNA Accounting for an Unusually Mild Form of Non-Herlitz.

Ahnak/Desmoyokin Is Dispensable for Proliferation, Differentiation, and Maintenance of Integrity in Mouse Epidermis Michiyoshi Kouno, Gen Kondoh, Kyoji.

Naoko Kanda, Shinichi Watanabe Journal of Investigative Dermatology

A Novel XPA Gene Mutation and its Functional Analysis in a Japanese Patient with Xeroderma Pigmentosum Group A Miki Tanioka, Arief Budiyant, Takahiro.

Interleukin-13 Receptor in Psoriatic Keratinocytes: Overexpression of the mRNA and Underexpression of the Protein Juan C. Cancino-Díaz, Elba Reyes-Maldonado,

Judith A. Mack, Edward V. Maytin Journal of Investigative Dermatology

Cyclooxygenase-2 Inhibitor Enhances Whereas Prostaglandin E2Inhibits the Production of Interferon-Induced Protein of 10 kDa in Epidermoid Carcinoma A431

Expression of T-Cadherin in Basal Keratinocytes of Skin

Michael F. Naso, Bailin Liang, C

Characterization of the Human Hair Keratin–Associated Protein 2 (KRTAP2) Gene Family Hiroki Fujikawa, Atsushi Fujimoto, Muhammad Farooq, Masaaki Ito,

Wound Healing Is Defective in Mice Lacking Tetraspanin CD151

Mechanism Underlying ATP Release in Human Epidermal Keratinocytes

Characterization of Keratinocyte Differentiation Induced by Ascorbic Acid: Protein Kinase C Involvement and Vitamin C Homeostasis1 Isabella Savini, Antonello.

YAP and TAZ Regulate Skin Wound Healing

Regulation of the Expression of Peptidylarginine Deiminase Type II Gene (PADI2) in Human Keratinocytes Involves Sp1 and Sp3 Transcription Factors Sijun.

The p73 Gene Is an Anti-Tumoral Target of the RARβ/γ-Selective Retinoid Tazarotene Marina Papoutsaki, Mauro Lanza, Barbara Marinari, Steven Nisticò, Francesca.

Homozygous Mutations in the 5′ Region of the JUP Gene Result in Cutaneous Disease but Normal Heart Development in Children Rita M. Cabral, Lu Liu, Carol.

Mitogen- and Stress-Activated Protein Kinase 2 and Cyclic AMP Response Element Binding Protein are Activated in Lesional Psoriatic Epidermis Anne T.

Ruth Halaban, Elaine Cheng Journal of Investigative Dermatology

17β-Estradiol Inhibits Oxidative Stress-Induced Apoptosis in Keratinocytes by Promoting Bcl-2 Expression Naoko Kanda, Shinichi Watanabe Journal of Investigative.

IgG Autoantibodies from Bullous Pemphigoid (BP) Patients Bind Antigenic Sites on Both the Extracellular and the Intracellular Domains of the BP Antigen.

Jittima Dhitavat, Leonard Dode, Natalie Leslie, Anavaj Sakuntabhai

Effect of Tenascin-C Deficiency on Chemically Induced Dermatitis in the Mouse Yoh-ichi Koyama, Masashi Kusubata, Atsushi Yoshiki, Noriko Hiraiwa, Tomoo.

Autoantibodies to BP180 Associated with Bullous Pemphigoid Release Interleukin-6 and Interleukin-8 from Cultured Human Keratinocytes Enno Schmidt, Stanislaus.

IgG Autoantibodies from Bullous Pemphigoid Patients Recognize Multiple Antigenic Reactive Sites Located Predominantly Within the B and C Subdomains of.

Requirement of Dynactin p150Glued Subunit for the Functional Integrity of the Keratinocyte Microparasol H. Randolph Byers, Sarah G. Dykstra, Sandrine.

Defining the Regulatory Elements in the Proximal Promoter of ΔNp63 in Keratinocytes: Potential Roles for Sp1/Sp3, NF-Y, and p63 Rose-Anne Romano, Barbara.

A Mutation in the V1 Domain of K16 is Responsible for Unilateral Palmoplantar Verrucous Nevus Alessandro Terrinoni, Vincenzo De Laurenzi, Eleonora Candi,

The Human Dermokine Gene: Description of Novel Isoforms with Different Tissue- Specific Expression and Subcellular Location Eve Toulza, Marie-Florence.

Loss of Novel mda-7 Splice Variant (mda-7s) Expression is Associated with Metastatic Melanoma1 Matthew Allen, Barbara Pratscher, Florian Roka, Clemens.

A Conserved Interaction between SKIP and SMP1/2 Aids in Recruiting the Second-Step Splicing Factors to the Spliceosome in Arabidopsis Lei Liu, Fangming.

All-Trans Retinoic Acid Antagonizes UV-Induced VEGF Production and Angiogenesis via the Inhibition of ERK Activation in Human Skin Keratinocytes Mi-Sun.

Identification of Skn-1n, a Splice Variant Induced by High Calcium Concentration and Specifically Expressed in Normal Human Keratinocytes Koji Nakajima,

Naoko Kanda, Shinichi Watanabe Journal of Investigative Dermatology

Bart A. Jessen, Marjorie A. Phillips, Robert H. Rice

Presentation transcript:

Identification of Transglutaminase 3 Splicing Isoforms Loredana Zocchi, Alessandro Terrinoni, Eleonora Candi, Bijan Ahvazi, Giacinto Bagetta, M. Tiziana Corasaniti, Anna M. Lena, Gerry Melino Journal of Investigative Dermatology Volume 127, Issue 7, Pages 1791-1794 (July 2007) DOI: 10.1038/sj.jid.5700768 Copyright © 2007 The Society for Investigative Dermatology, Inc Terms and Conditions

Figure 1 Cloning and detection of mouse and hTG3-splicing variants. (a) EcoRI digestion of mouse TG3 (mTG3) in lanes 1, 3, and 4. The Δ6,7 variant is represented by one band of 970bp; in lane 2, two bands of 920bp, and 1,290bp represents a wild-type (Wt) colony; the 3kbp band is the empty vector (amplification primers +ACACCATCTCTGTCATTCCC, -CTGGACAACATAGGCAACA). (b) Schematic representation of mTG3-splicing variant. The gray box indicates the new six amino acids and the premature stop codon. (c) EcoRI digestion of hTG, in lanes 3, 6, and 7; two bands of 840 and 1,270bp represents the Wt colonies, in lane 5 the band of 1,550bp represents the Δ9,10 variant (amplification primers +CTGAGAAGAGGCAGAGGAAGG, -TCATTCGGCTACATCGATGGAC). (d) Schematic representation of hTG3-splicing variant. (e) Semiquantitative reverse transcription–PCR on differentiated normal human epidermal keratinocyte (0, 2, 4, 6, and 9 days with 1.2mm Ca2+). The upper panel shows the amplification of hTG3. The high-molecular-weight band is the Wt amplification (850bp), whereas the lower one is the spliced isoform (290bp). The lower panel shows the housekeeping β-actin. (f) Semiquantitative reverse transcription–PCR on RNA extracted from skin biopsies of normal (Wt) and lamellar ichthyosis individuals (lanes 1, 2, 3, and 4). The upper band is the Wt band, the lower band represents the spliced isoform, in the lower panel is shown the housekeeping (β-actin) (hTG3 primers: +ATGACACAGACCGAAATCT, -ACTCATCTGGGACCTTGC). Journal of Investigative Dermatology 2007 127, 1791-1794DOI: (10.1038/sj.jid.5700768) Copyright © 2007 The Society for Investigative Dermatology, Inc Terms and Conditions

Figure 2 Modelling and crosslinking activity of 9,10 hTG3 isoform. (a) Left panel: crosslinking activity measurements of Wt and Δ9,10 hTG3 proteins; right panel: quantitative reverse transcription–PCR on HEK-293-transfected cells (primers hTG3: +TATCAGCATCTCCAGTCCTGCC, -GCCAATTCGGTTTGTGCTTCC; green fluorescent protein: +GCTGACCCTGAAGTTCATCTG, -TCTTGTAGTTGCCGTCGTCC on ABI7500 + SYBRII). (b) Western blot on transfected HEK-293 cells, using anti-myc tag antibody, for TG3 Wt (80kDa, lane 1) and Δ9,10 (55kDa, lane 2) empty vector (lane 3). Housekeeping normalization, β-tubulin; transfection efficiency normalization, green fluorescent protein. (c) Front and (d) back view of a model hTG3, the images are rotated 180° with respect to each other. The orange protein regions represent the portions missed by Δ9,10 alternative splicing. The yellow circle (arrow) inside the orange region is the Ca2+ ion inside the Ca2+ second binding site. Journal of Investigative Dermatology 2007 127, 1791-1794DOI: (10.1038/sj.jid.5700768) Copyright © 2007 The Society for Investigative Dermatology, Inc Terms and Conditions