Volume 22, Issue 15, Pages (August 2012)

Slides:



Advertisements
Similar presentations
The Hunt for Chromosomal Determinants of Maleness— A gene mapping story……. The Hunt for Chromosomal Determinants of Maleness— A gene mapping story…….
Advertisements

SRY Gene on Chromosome Y Jon Scales Genetics Fall GTAACAAAGAATCTGGTAGAAGTGAGTTTTGGATAGTAAAATAAGTTTCGAACTCTGGCA 61 CCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACAATGCAATCATATGCTTCTGCTATG.
Inheritance Patterns and Human Genetics. Learning Intention Fill In Understand how the patterns of ___________ ____________can used to _________ and ___________.
Volume 1, Issue 4, Pages (March 1998)
A Robust Network of Double-Strand Break Repair Pathways Governs Genome Integrity during C. elegans Development  Daphne B. Pontier, Marcel Tijsterman 
Visualization of trans-Homolog Enhancer-Promoter Interactions at the Abd-B Hox Locus in the Drosophila Embryo  Matthew Ronshaugen, Mike Levine  Developmental.
Mark M Metzstein, H.Robert Horvitz  Molecular Cell 
John F. Golz, Emma J. Keck, Andrew Hudson  Current Biology 
Volume 16, Issue 10, Pages (May 2006)
Genetic Consequences of Programmed Genome Rearrangement
Volume 14, Issue 5, Pages (March 2004)
Volume 21, Issue 15, Pages (August 2011)
Volume 9, Issue 20, Pages S1-S2 (October 1999)
A Member of a Gene Family on Xp22
A Hypervariable Invertebrate Allodeterminant
Zebrafish as a Model System to Study Skin Biology and Pathology
Volume 16, Issue 9, Pages (May 2006)
Volume 21, Issue 8, Pages (April 2011)
Volume 24, Issue 7, Pages (March 2014)
Volume 48, Issue 2, Pages (October 2005)
Volume 25, Issue 24, Pages (December 2015)
Volume 21, Issue 12, Pages (June 2011)
Evolutionary Origin of the Medaka Y Chromosome
Volume 19, Issue 19, Pages (October 2009)
Volume 91, Issue 6, Pages (December 1997)
Sex Determination: Time for Meiosis? The Gonad Decides
Hox Gene Loss during Dynamic Evolution of the Nematode Cluster
John F. Golz, Emma J. Keck, Andrew Hudson  Current Biology 
Volume 1, Issue 4, Pages (March 1998)
Volume 10, Issue 8, Pages (April 2000)
A Human Homologue of the Drosophila melanogaster diaphanous Gene Is Disrupted in a Patient with Premature Ovarian Failure: Evidence for Conserved Function.
Kimberle Shen, Harwin Sidik, William S. Talbot  Cell Reports 
Volume 14, Issue 16, Pages (August 2004)
Volume 17, Issue 21, Pages (November 2007)
Hiroaki Matsunami, Linda B Buck  Cell 
Volume 8, Issue 6, Pages (September 2014)
The Host Restriction Factor APOBEC3G and Retroviral Vif Protein Coevolve due to Ongoing Genetic Conflict  Alex A. Compton, Vanessa M. Hirsch, Michael.
Volume 18, Issue 10, Pages (May 2008)
Volume 22, Issue 15, Pages (August 2012)
Volume 11, Issue 19, Pages (October 2001)
Volume 19, Issue 10, Pages (May 2009)
Qiong A. Liu, Michael O. Hengartner  Current Biology 
Karmella A. Haynes, Amy A. Caudy, Lynne Collins, Sarah C.R. Elgin 
The Chemokine SDF1a Coordinates Tissue Migration through the Spatially Restricted Activation of Cxcr7 and Cxcr4b  Guillaume Valentin, Petra Haas, Darren.
A Novel Class of MYB Factors Controls Sperm-Cell Formation in Plants
Michael A. Rogers, Hermelita Winter, Christian Wolf, Jürgen Schweizer 
P granules Current Biology
Developmental Basis of Phallus Reduction during Bird Evolution
Volume 11, Issue 15, Pages (August 2001)
insomniac and Cullin-3 Regulate Sleep and Wakefulness in Drosophila
Sex-Linked period Genes in the Silkmoth, Antheraea pernyi
The abcc6a Gene Expression Is Required for Normal Zebrafish Development  Qiaoli Li, Sara Sadowski, Michael Frank, Chunli Chai, Andras Váradi, Shiu-Ying.
Volume 18, Issue 9, Pages (May 2008)
Identical Skin Toxins by Convergent Molecular Adaptation in Frogs
Volume 7, Issue 2, Pages (August 2010)
The Gene Mutated in Variant Late-Infantile Neuronal Ceroid Lipofuscinosis (CLN6) and in nclf Mutant Mice Encodes a Novel Predicted Transmembrane Protein 
Volume 57, Issue 3, Pages (March 2000)
FOXL2 Is a Female Sex-Determining Gene in the Goat
Volume 10, Issue 4, Pages (February 2000)
Volume 8, Issue 6, Pages (September 2014)
Volume 26, Issue 17, Pages (September 2016)
Volume 26, Issue 1, Pages (April 2000)
Horizontal gene transfer and the evolution of cnidarian stinging cells
Sex Chromosome Effects on Male–Female Differences in Mammals
Volume 21, Issue 23, Pages (December 2011)
Mutation of the Ca2+ Channel β Subunit Gene Cchb4 Is Associated with Ataxia and Seizures in the Lethargic (lh) Mouse  Daniel L Burgess, Julie M Jones,
Arabidopsis RPA2: A Genetic Link among Transcriptional Gene Silencing, DNA Repair, and DNA Replication  Taline Elmayan, Florence Proux, Hervé Vaucheret 
Nitric oxide synthase is not essential for Drosophila development
Identification of a New Splice Form of the EDA1 Gene Permits Detection of Nearly All X- Linked Hypohidrotic Ectodermal Dysplasia Mutations  Alex W. Monreal,
Volume 97, Issue 6, Pages (June 1999)
Presentation transcript:

Volume 22, Issue 15, Pages 1423-1428 (August 2012) An Immune-Related Gene Evolved into the Master Sex-Determining Gene in Rainbow Trout, Oncorhynchus mykiss  Ayaka Yano, René Guyomard, Barbara Nicol, Elodie Jouanno, Edwige Quillet, Christophe Klopp, Cédric Cabau, Olivier Bouchez, Alexis Fostier, Yann Guiguen  Current Biology  Volume 22, Issue 15, Pages 1423-1428 (August 2012) DOI: 10.1016/j.cub.2012.05.045 Copyright © 2012 Elsevier Ltd Terms and Conditions

Figure 1 Rainbow Trout sdY Gene and Predicted Protein Structure and Evolution (A) Alignments of the sdY gene on the OmyY1 Y-specific genomic sequence (GenBank accession number EU081756). The nucleotide positions of the intron/exon boundaries and codon numbers are indicated. The sdY gene is composed of four exons that span 7,694 kb of the OmyY1 sequence and encodes a putative protein of 192 amino acids. (B) Comparison of rainbow trout Irf9a and SdY protein structures with the corresponding Pfam domains (bit scores and e values are given for each significant domain). ClustalW protein alignment of these two proteins shows that in their overlapping regions corresponding to the IRF-associated domain (IAD), Irf9a and SdY share a 47% identity. Identical amino acid residues are represented as dots on the SdY sequence, and similar amino acid residues are shaded. (C) Phylogenetic analysis (maximum likelihood) of the IAD of teleost interferon regulatory factor proteins with rainbow trout SdY reveals an evolutionary relationship with the IAD of fish Irf9 and SdY proteins. Additional phylogenetic analyses (neighbor joining and Bayesian inference) supporting this conclusion are given in Figure S1. The sequence accession numbers for the proteins retained in the analyses are given in Supplemental Experimental Procedures. Bootstrap values are indicated at each branch's nodes. Current Biology 2012 22, 1423-1428DOI: (10.1016/j.cub.2012.05.045) Copyright © 2012 Elsevier Ltd Terms and Conditions

Figure 2 Expression of the sdY Gene in Rainbow Trout (A) Whole-mount in situ hybridization of rainbow trout male and female embryos at 32 days postfertilization (dpf). sdY is expressed only in male differentiating testis in somatic epithelial cells on the dorsal side of the gonad (ds-ec), with strong expression (arrow) detected in one cell located just below the germ cell (gc) or surrounding the somatic germ cell (sgc). No expression was detected in any female at any stage. The ventral side (vs) of the gonad corresponds to the side facing the internal part of the peritoneal cavity. (B) Expression of the rainbow trout sdY gene during early gonadal differentiation in male (♦) and female (■) gonads. (C and D) Expression of sdY in adult tissues (C) and during spermatogenesis (D). Each histogram (black columns) represents the mean ± SD of sdY expression in three different biological samples, with the exception of differentiating testis (white columns), for which the data represent a single measurement of pooled gonads sampled between 55 and 62 dpf. The pound sign (#) indicates not detected. Current Biology 2012 22, 1423-1428DOI: (10.1016/j.cub.2012.05.045) Copyright © 2012 Elsevier Ltd Terms and Conditions

Figure 3 sdY Is Male-Specific and Tightly Linked with the SEX Locus in the Rainbow Trout (A) PCR coamplification of sdY and 18S (positive control) in male and female (n = 5) genomic DNA samples from rainbow trout. (B) Genetic mapping showing that sdY maps to the rainbow trout sex linkage group (RT01) and colocalizes with the sex-determining locus (SEX). CEN, centromere. Current Biology 2012 22, 1423-1428DOI: (10.1016/j.cub.2012.05.045) Copyright © 2012 Elsevier Ltd Terms and Conditions

Figure 4 sdY Is Both Necessary and Sufficient to Trigger Testicular Differentiation (A) Female-to-male sex inversion of adult F0 sdY transgenic (Tg) XX fish. Oo, oocyte; Cy, cyst; Sp, spermatozoids. Scale bars represent 100 μm. (B) Sequences of sdY with some ZFN-induced mutations (see Figure S2 for the detection of the mutations). The 23 bp deletion in sdY exon 2 (Δ23) creates a frameshift that leads to the formation of a premature stop codon. The deletion of 4 bp followed by the insertion of 7 bp (Δ4; +7) leads to the replacement of two amino acids by three different amino acids. (C) Male-to-female sex inversion of 90 dpf sdY XY fish with mutations in the sdY gene. Both mutations induce ovarian differentiation characterized by the presence of ovarian lamellae (Ol) and meiotic germ cells (gC). The inset shows a higher magnification of the meiotic germ cells. Scale bars represent 50 μm. Current Biology 2012 22, 1423-1428DOI: (10.1016/j.cub.2012.05.045) Copyright © 2012 Elsevier Ltd Terms and Conditions