DNA Crash course…..

Slides:

Advertisements

Similar presentations

Gene-Proteins-Mutations

Advertisements

Transcription and translation

RNA and Protein Synthesis

What was the most interesting thing that you did over Winter Break? Create a double bubble map comparing/contrasting DNA and RNA.

Transcription and Translation

Protein Synthesis What is transcription? What is translation?

Protein synthesis and replication

 Assemble the DNA  Follow base pair rules  Blue—Guanine  Red—Cytosine  Purple—Thymine  Green--Adenine.

TRNA. Transfer RNA (tRNA) is a small molecule, existing as a single- strand that is folded into a clover-leaf shape.

Transcription Transcription is the synthesis of mRNA from a section of DNA. Transcription of a gene starts from a region of DNA known as the promoter.

Transcription and Translation

CENTRAL DOGMA OF BIOLOGY. Transcription & Translation How do we make sense of the DNA message? Genotype to Phenotype.

From Gene to Protein Chapter 17.

Translation Translation takes the “message” carried by mRNA and turns it into proteins This happens in the ribosomes (protein factories)

Molecular Biology in a Nutshell (via UCSC Genome Browser) Personalized Medicine: Understanding Your Own Genome Fall 2014.

Protein Synthesis 6C transcription & translation.

8.4 Transcription KEY CONCEPT Transcription converts a gene into a single-stranded RNA molecule.

The big picture………

DNA TO RNA Transcription is the process of creating a molecule that can carry the genetic blueprint for a particular protein coding gene from the DNA.

12-3 RNA and Protein Synthesis

Review of Protein Synthesis. Fig TRANSCRIPTION TRANSLATION DNA mRNA Ribosome Polypeptide (a) Bacterial cell Nuclear envelope TRANSCRIPTION RNA PROCESSING.

Outline What is an amino acid / protein

DNA RNA Cell Membrane - Protection, transporters, sensors Nucleus - Information (the genes) THE CELL.

While replication, one strand will form a continuous copy while the other form a series of short “Okazaki” fragments Genetic traits can be transferred.

GENOME: an organism’s complete set of genetic material In humans, ~3 billion base pairs CHROMOSOME: Part of the genome; structure that holds tightly wound.

Step One: Transcription

The beginning of protein synthesis. OVERVIEW  Uses a strand of nuclear DNA to produce a single-stranded RNA molecule  Small section of DNA molecule.

Protein Synthesis Making proteins – one of the jobs of genes.

DNA Structure. The Flow of Genetic Information from DNA to RNA to Protein –DNA functions as the inherited directions for a cell or organism. Copyright.

Higher Human Biology Unit 1 Human Cells KEY AREA 3: Gene Expression.

Introduction to molecular biology Data Mining Techniques.

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

Genetic Code and Interrupted Gene Chapter 4. Genetic Code and Interrupted Gene Aala A. Abulfaraj.

Chapter – 10 Part II Molecular Biology of the Gene - Genetic Transcription and Translation.

Journal #4: In DNA, which nucleotide pairs with Adenine? Guanine? Which DNA nucleotide is not represented in RNA? Fun Fact: Every human spent about half.

Protein Synthesis (Transcription and Translation)

CENTRAL DOGMA OF BIOLOGY

Protein Synthesis-How do we go from genotype to phenotype

The Central Dogma Transcription & Translation

Transcription and Translation

Higher Biology Gene Expression Mr G R Davidson.

The making of proteins for …..

RNA and Protein Synthesis

RNA and Protein Synthesis

Transcription and Translation

Notes – Protein Synthesis: Translation

Protein Synthesis in Detail

Gene architecture and sequence annotation

RNA February 3rd/4th, 2009.

Transcription and Translation

Outline What is an amino acid / protein

Transcription and Translation

Transcription and Translation

Transcription and Translation

Transcription and Translation

How genes on a chromosome determine what proteins to make

Transcription and Translation

RNA and Protein Synthesis

GENE EXPRESSION / PROTEIN SYNTHESIS

Structure of the Genome

From gene to protein.

Key Area 1.3 – Gene Expression

mRNA that makes sense in our terms:

Transcription & Translation

Transcription and the RNA code

Protein Synthesis.

Transcription and Translation

12-3: RNA and Protein Synthesis (part 1)

Presentation transcript:

DNA Crash course….

A K J I B H E G D C F Amylase Lipase Pepsin Mucus Collagen Insulin Keratin Melanin D C Antibodies Muscle F Haemoglobin

A T C G x 3,000,0000,000… (in human genome)

ATCGGGCCATTCGAATCTAGCATTGAAACGAGTGAGCGAAACGAGCGACTTATTTGGCTAGACAGCTGAGCAGTCGACTCCAGCTGACAGCTGACGACTGAGAAGAGGCTCCAGCTCAGACAGCTAGCGACCTTCAGCTAGCTAGCGGCAGTCAGCTTCAGCTGAACGCAGCTAGCCCTTCAGGACTCTCAGGAGCTCCTCGACAGAGCAGCGATCAGCAGCTTAGGAGAGAGCCTTCAGGAGTCAGGTTTCCATCGGTCGGTACGGTACGACAGCTGAGAGCTCTAGCTAGCCCTTCAGCAGCTAGCTGACTAGGACGACGACTAGCGTACGTACTGACTTAGAGCGACTCTCTCCTAGGACTAGCTAGCTAGGAGCTCTCTCAGACGCTAGAGCTGACCTCTCTCAGAGAGCTAGCTAGCGCGAGTATCGGGCCATTCGAATCTAGCATTGAAACGAGTGAGCGAAACGAGCGACTTATTTGGCTAGACAGCTGAGCAGTCGACTCCAGCTGACAGCTGACGACTGAGAAGAGGCTCCAGCTCAGACAGCTAGCGACCTTCAGCTAGCTAGCGGCAGTCAGCTTCAGCTGAACGCAGCTAGCCCTTCAGGACTCTCAGGAGCTCCTCGACAGAGCAGCGATCAGCAGCTTAGGAGAGAGCCTTCAGGAGTCAGGTTTCCATCGGTCGGTACGGTACGACAGCTGAGAGCTCTAGCTAGCCCTTCAGCAGCTAGCTGACTAGGACGACGACTAGCGTACGTACTGACTTAGAGCGACTCTCTCCTAGGACTAGCTAGCTAGGAGCTCTCTCAGACGCTAGAGCTGACCTCTCTCAGAGAGCTAGCTAGCGCGAGT ATCGGGCCATTCGAATCTAGCATTGAAACGAGTGAGCGAAACGAGCGACTTATTTGGCTAGACAGCTGAGCAGTCGACTCCAGCTGACAGCTGACGACTGAGAAGAGGCTCCAGCTCAGACAGCTAGCGACCTTCAGCTAGCTAGCGGCAGTCAGCTTCAGCTGAACGCAGCTAGCCCTTCAGGACTCTCAGGAGCTCCTCGACAGAGCAGCGATCAGCAGCTTAGGAGAGAGCCTTCAGGAGTCAGGTTTCCATCGGTCGGTACGGTACGACAGCTGAGAGCTCTAGCTAGCCCTTCAGCAGCTAGCTGACTAGGACGACGACTAGCGTACGTACTGACTTAGAGCGACTCTCTCCTAGGACTAGCTAGCTAGGAGCTCTCTCAGACGCTAGAGCTGACCTCTCTCAGAGAGCTAGCTAGCGCGAGT

Triplet code CTG GCC TAG AAT CCA ATG Called “codons” – code for amino acids Start of gene indicated with a Start codon – ATG – codes for Methionine (M) End of gene indicated with a Stop codon –(TAG, TAA, TGA)

double helix anti-parallel

5’ 3’ A C T G T A G C T 3’ 5’

5ATGGGGCCATTCGAATCTAG…. lotsandlotsandlotsofbases… 5ATGGGGCCATTCGAATCTAG….lotsandlotsandlotsofbases….AGCGATTATTTGGCTAGACAGTAA3 3AATGGGCCATTCGAATCTAG….lotsandlotsandlotsofbases….AGCGATTATTTGGCTAGACAGGTA5

DNA RNA Protein Protein TRANSCRIPTION TRANSLATION ATTCCGATGGGT TAAGGCATCCCA AUUCCGAUGGGU TRANSCRIPTION TRANSLATION

“curating” the genes… introns and exons and splicing…. your job… “curating” the genes… introns and exons and splicing….

RUDOLPHXXXXTHEXXXREDXXXXXXXXNOSEDXXXXXXXXXXREINXXXDEERXXXXXXXXXXXHADAXXXXVERYXXXSHINYXXXXNOSE GENE (DNA) RUDOLPHXXXXTHEXXXREDXXXXXXXXNOSEDXXXXXXXXXXREINXXXDEERXXXXXXXXXXXHADAXXXXVERYXXXSHINYXXXXNOSE Transcribed mRNA edited mRNA (introns removed RUDOLPHTHEREDNOSEDEAREDREINDEERHADAVERYSHINYNOSE

Intron Exon 5’UTR CDS CDS CDS 3’UTR Start codon (ATG) here Stop codon here

Whipworm genome 3 chromosomes 80,000,000 base pairs (i.e. DNA letters) In fragments (chromosomes 1 and 3 not fully reconstructed) e.g. chromosome 1 in 7 fragments (aka “scaffolds”) OHS allocated a scaffold to annotate

What next? Dr W will send e-mail with introduction to Apollo – watch the training videos! Once you’ve done this, collect your avatar and log-in details from Dr W You can then log into Apollo and try the training exercises Learn by doing!!!!! You may prefer to work in pairs or small groups