DNA, RNA, and Mutations Study guide review

If the mRNA codon is AUG what would the matching tRNA anticodon be? UAC

List the events that take place during protein synthesis in order. DNA serves as a template for mRNA production in nucleus- transcription mRNA moves to the cytoplasm and attaches to a ribosome; tRNA molecules carrying amino acids bond to specific codons on mRNA and amino acids peptide bond together to build polypeptide-translation

What are the sides of a DNA molecule made of? Sugar & phosphate group

Define gene. A sequence of DNA that codes for a protein

If the mRNA codon for Proline is GGA what would be the DNA code (triplet) for this amino acid? CCT

How many hydrogen bonds form between Adenine & Thymine? 2

How many hydrogen bonds form between Cytosine & Guanine? 3

A group of 3 nucleotides in tRNA that is complementary to mRNA Define anticodon. A group of 3 nucleotides in tRNA that is complementary to mRNA

Where does transcription take place in the cell? Nucleus

Who were the two people that are credited with the discovery of DNA’s structure? Watson and Crick

Define replication. Process by which DNA is copied— resulting in two DNA molecules each with one new strand and one original strand -called semi-conservative replication

What part of the cell contains DNA? Nucleus

Define transcription. Process by which DNA is used as a template to make mRNA.

What are the base pairs that make up DNA? A-T, C-G

What are the components of a nucleotide? Phosphate group, 5-C sugar, nitrogenous base

Define codon. A set of 3 nucleotides in mRNA that are complementary to DNA

Define anticodon a group of 3 nucleotides in tRNA that is complementary to mRNA

If a sequence of DNA contains the following bases, what would the complementary base sequence be? ATCGGATTAGCC TAGCCTAATCGG

Describe the three different types of RNA & their function. mRNA carries the information of DNA from the nucleus to the cytoplasm   tRNA transfers each amino acid to the ribosome as it is specified by the coded messages in mRNA rRNA aids in the assembly of proteins and makes up part of the ribosome

Where does tRNA attach? to a specific mRNA codon as it is read by the ribosome

Where are proteins manufactured in the cell? ribosomes

What is the genetic code? The sequence of amino acids that give a person their genetic information.

Which molecule carries the anticodon? tRNA

What did Chargaff discover? Equal amounts of A & T and C &G in samples of DNA- explains base pairing

What are the nucleotides found in DNA? A, T, C, G

What are the nucleotides found in RNA? A, U, C, G

How did Rosalind Franklin study DNA? X-RAY diffraction

Define translation. Process when the sequence of mRNA is decoded into a protein

Where does translation occur? Cytoplasm

What are introns? portions of RNA that are cut out and discarded

What are exons? remaining pieces of RNA after introns are cut out that are spliced back together to form the final mRNA

What does RNA polymerase do? separates DNA strands and uses one strand of DNA as a template to assemble nucleotides into a complementary strand of mRNA

Give the mRNA sequence for the following DNA strand: AAGTATAC UUCAUAUG

What is the start codon? Which amino acid does it code for? AUG- methionine

What is the structure of DNA called? Who is responsible for this name? Double helix- Watson & Crick

15 bases= 5 codons= 5 amino acids Given the following DNA sequence, how many amino acids does it code for? ATCCTTGATTCCGCA 5 15 bases= 5 codons= 5 amino acids

What does DNA stand for? What is its purpose? Deoxyribonucleic acid- the molecule of heredity

What does RNA stand for? What is its purpose? Ribonucleic acid- carries out instructions coded in DNA

What are the differences between DNA & RNA?   Sugar # of Strands Bases DNA deoxyribose 2 A, T,C, G RNA ribose 1 A, U, C, G

In the cytoplasm, messenger RNA becomes attached to the RIBOSOME

Explain DNA replication. DNA helicase separates the double helix and then DNA polymerase “synthesizes” two new strands using originals as templates following base pairing rules; produces two DNA molecules each with one new strand and one original strand

What makes up a nucleotide? phosphate group, 5-C sugar, nitrogenous base

Where is mRNA synthesized? NUCLEUS

What is the enzyme responsible for replication? Transcription? DNA polymerase- replication RNA polymerase- transcription

Describe 5 mutations for DNA that lead to beneficial or harmful changes in a gene. Missense-substitution affects 1 amino acid Insertion and Deletion- changes reading frame Nonsense- premature stop codon CHOMOSOME Deletion- part of chromosome is lost Translocation- chromosomal rearrangements Inversions and insertions- sequencing issues

A random change in an organism’s genetic information is a mutation

A group of 3 nucleotides in tRNA that is complimentary to mRNA is called the anticodon

DNA replication results in two DNA molecules each with one new strand and one original strand. TRUE or FALSE

Describe missense, nonsense, and silent mutations Silent: does not change the amino acid sequence Missense: changes one amino acid in the resulting protein Nonsense: premature stop codon shortens the resulting protein

ALWAYS use the given template DNA! DNA template TACAATTGCCCCCGGGCAATT Comp DNA ATGTTAACGGGGGCCCGTTAA mRNA codons AUG-UUA-ACG-GGG-GCC-CGU-UAA amino acids met-leu-thre-gly-ala-arg-stop tRNA anticodons UAC-AAU-UGC-CCC-CGG-GCA-AUU