Exploring a Putative Gene

Slides:



Advertisements
Similar presentations
Exploiting transcription factor binding site clustering to identify cis-regulatory modules involved in pattern formation in the Drosophila genome ECS289A.
Advertisements

Combined analysis of ChIP- chip data and sequence data Harbison et al. CS 466 Saurabh Sinha.
Genomic Innovations- Orthology Paralogy. Genomic innovation.
Ab initio gene prediction Genome 559, Winter 2011.
Predicting the Function of Single Nucleotide Polymorphisms Corey Harada Advisor: Eleazar Eskin.
Alternative splicing and evolution Daniel Jeffares.
Protein Modules An Introduction to Bioinformatics.
Sequence Analysis. Today How to retrieve a DNA sequence? How to search for other related DNA sequences? How to search for its protein sequence? How to.
MCB 317 Genetics and Genomics MCB 317 Topic 10, part 3 A Story of Transcription.
Arabidopsis Gene Project GK-12 April Workshop Karolyn Giang and Dr. Mulligan.
Identifying conserved promoter motifs and transcription factor binding sites in plant promoters Endre Sebestyén, ARI-HAS, Martonvásár, Hungary 26th, November,
Functional Linkages between Proteins. Introduction Piles of Information Flakes of Knowledge AGCATCCGACTAGCATCAGCTAGCAGCAGA CTCACGATGTGACTGCATGCGTCATTATCTA.
Screening a Library Plate out library on nutrient agar in petri dishes. Up to 50,000 plaques or colonies per plate.
Transcription Factors … (TF) Transcription in eukaryote -controlled by trans-acting protein … TF -more complex than in prokaryotes.
Identification of Protein Domains. Orthologs and Paralogs Describing evolutionary relationships among genes (proteins): Two major ways of creating homologous.
발표자 석사 2 년 김태형 Vol. 11, Issue 3, , March 2001 Comparative DNA Sequence Analysis of Mouse and Human Protocadherin Gene Clusters 인간과 마우스의 PCDH 유전자.
Multiple Alignment and Phylogenetic Trees Csc 487/687 Computing for Bioinformatics.
COURSE OF BIOINFORMATICS Exam_31/01/2014 A.
You have worked for 2 years to isolate a gene involved in axon guidance. You sequence the cDNA clone that contains axon guidance activity. What do you.
Comparative genomics analysis of NtcA regulons in cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis Wen-Ting Huang.
Condor: BLAST Monday, July 19 th, 3:15pm Alain Roy OSG Software Coordinator University of Wisconsin-Madison.
Localising regulatory elements using statistical analysis and shortest unique substrings of DNA Nora Pierstorff 1, Rodrigo Nunes de Fonseca 2, Thomas Wiehe.
Condor: BLAST Rob Quick Open Science Grid Indiana University.
Brief Overview of Macromolecules DNA, RNA, and Proteins.
Exploring and Exploiting the Biological Maze Zoé Lacroix Arizona State University.
What is so memorable about CREBBP? (RSTS; RTS, CBP CBP/MOZ FUSION GENE, CREB-binding protein)
Bioinformatics Workshops 1 & 2 1. use of public database/search sites - range of data and access methods - interpretation of search results - understanding.
Gene models and proteomes for Saccharomyces cerevisiae (Sc), Schizosaccharomyces pombe (Sp), Arabidopsis thaliana (At), Oryza sativa (Os), Drosophila melanogaster.
COURSE OF BIOINFORMATICS Exam_30/01/2014 A.
Eukaryotic genes are interrupted by large introns. In eukaryotes, repeated sequences characterize great amounts of noncoding DNA. Bacteria have compact.
Mahmuda Akter, Paige Fairrow-Davis, and Rebecca Seipelt-Thiemann
The Transcriptional Landscape of the Mammalian Genome
Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 2016 Workshop
EPIGENETICS Textbook Fall 2013.
A Member of the Kekkon Protein Family Ryan Allis Sean Boyle
3.2 Chromosomes Chromosomes carry genes in a linear sequence that is shared by members of a species.
Sequence based searches:
AML1/Runx1 and oncogenic transformation
Genome Center of Wisconsin, UW-Madison
Mark M Metzstein, H.Robert Horvitz  Molecular Cell 
Recitation 7 2/4/09 PSSMs+Gene finding
3.2 - Chromosomes.
Bioinformatics and BLAST
Relationship between Genotype and Phenotype
Every living organism inherits a blueprint for life from its parents.
Strategies for annotation of a genome
by Chi Wai So, and Michael L. Cleary
Evolution of eukaryote genomes
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Analysis of perA integrity within nonhybrid Epichloë species.
Purposes: To demonstrate the tendency of proteins to become longer with increase of organism complexity To study domain architecture of proteins and to.
Identify D. melanogaster ortholog
Relationship between Genotype and Phenotype
TRANSLATED BY: KARUN RAJESH
Itai M. Pessach, MD, PhD, Luigi D. Notarangelo, MD 
A Novel MAP Kinase Regulates Flagellar Length in Chlamydomonas
Presented by, Jeremy Logue.
The Structure of the Genome
Volume 128, Issue 6, Pages (March 2007)
Gene Safari (Biological Databases)
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Basic Local Alignment Search Tool
Presented by, Jeremy Logue.
MOLECULAR GENETICS.
TF candidate selection pipeline.
The Ran GTPase: Theme and Variations
Condor: BLAST Tuesday, Dec 7th, 10:45am
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Gene regulatory regions of the insect/crustacean egr-B homologs.
Volume 26, Issue 1, Pages e3 (January 2018)
Presentation transcript:

Exploring a Putative Gene גיא וקסמן רועי נבון

Problem definition Taking one of the thousands of Putative genes that were “found” In the human genome project & Trying to determine whether this Sequence might be a real gene that can be translated into a protein product.

The Selected Gene: NM_014727 Homo sapiens myeloid/lymphoid or mixed-lineage leukemia 4 (MLL4).

PSI-BLAST

The Locus problem Many entrances are actually on the same locus (SNPs, flanking, different Alleles etc`).

Different Entrances on the Same Chromosomal Region

Conserved Domains CXXC zinc finger SET1 Zinc finger

2-BLAST 2-BLAST between the putative MLL4 gene & the most similar real Gene-Trithorax, from Drosophila Melanogaster. E=5e-87 E=2e-82

Multiple Alignment SET1 domain

3D Structure – Zinc Finger Domain

Biological Aspects Drosophila melanogaster ככה נראיתי פעם... The trithorax gene, a trans-acting regulator of the bithorax complex in Drosophila, encodes a protein with zinc-binding domains. Mazo AM, Huang DH, Mozer BA, Dawid IB ככה נראיתי פעם...

Homo Sapians Acute mixed-lineage leukemia t(4;11)(q21;q23) generates an MLL-AF4 fusion product

Conclusions 1. We found a high similarity between our putative gene and genes from other species. 2. The MLL4 putative gene contains at least 3 conserved domains. 3. The homologue genes from Drosophila and Human are associated with the nervous system and leukemia respectively.

Possible directions for future research 1. Trying to find DNA motifs which bind to our putative gene and to its homologues. 2. Trying to isolate the full length protein. 3. When 3D structure prediction will be available, we’ll try to compare our putative protein with other known proteins.