Unit 3: Heredity: Inheritance and Variation of Traits Part 1 Notes

DNA Structure Polymer (Nucleic Acids) made of many nucleotides (the monomer) Consist of a five-carbon sugar, a phosphate group, and a nitrogenous base

DNA Base Pairing Rules Adenine pairs with thymine Guanine pairs with cytosine Write the complementary strand: ACGTCC TGCAGG

Central Dogma DNARNAProtein

What is RNA? Ribonucleic Acid Contains the sugar ribose Usually is single stranded Four bases: Adenine Uracil (No thymine, which means Adenine pairs with Uracil) Cytosine Guanine

RNA Base Pairing Rules Adenine pairs with Uracil Guanine pairs with Cytosine

RNA Messenger RNA (mRNA) RNA nucleotides that are formed complementary to one strand of DNA and carries that information from the nucleus to the ribosomes Ribosomal RNA (rRNA) Associates with proteins to form ribosomes in the cytoplasm Transfer RNA (tRNA) Smaller segments of RNA nucleotides that transport amino acids to the ribosome

RNA Comparison

Protein Synthesis Composed of two parts Creates proteins Transcription DNARNA Translation RNAProtein Creates proteins Long chains of amino acids held together by peptide bonds

Transcription Through transcription, the DNA code is transferred to mRNA in the nucleus DNA is unzipped in the nucleus and RNA polymerase binds to a specific section where an mRNA will be synthesized A  U T  A G C C  G

RNA Processing The code on the DNA is interrupted periodically by sequences that are not in the final mRNA Intervening sequences are called introns Remaining pieces of DNA that serve as the coding sequences are called exons

The Code Experiments during the 1960s demonstrated that the DNA code was a three-base code The three-base code in DNA or mRNA is called a codon Ex: ACG or UGC

Translation In translation, tRNA molecules act as the interpreters of the mRNA codon sequence; bring the amino acids to the ribosome At the middle of the folded strand, there is a three-base coding sequence called the anticodon Each anticodon is complementary to a codon on the mRNA

Translation A  U U  A G C C  G Use the table to determine the amino acid based on the codons (three bases on the mRNA strand) Many amino acids form a protein During translation, if you get a stop codon, you no longer need to continue translation

One Gene—One Enzyme Hypothesis The Beadle and Tatum experiment showed that one gene codes for one enzyme. We now know that one gene codes for one polypeptide

Let’s Practice!

Translate the mRNA to Amino Acids using your chart mRNA: AUG AGC CCC GCG UAG GUU CUC Amino Acids: Met (Start) Ser Pro Ala Stop mRNA: AUG CUA GCU AUC GAU CGA UCG AA: Met (Start) Leu Ala lle Asp Arg Ser mRNA: AUG UGC AUA GAA CCG AUC GAU AA: Met (Start) Cys lle Glu Pro lle Asp

Translate your mRNA strand to Amino Acids and determine the anticodon (tRNA) mRNA: AUGAGCCCCGCGUAGGUUCUC Amino Acids: Met (Start) Ser Pro Ala Stop tRNA: UAC UCG GGG CGC AUC CAA GAG mRNA: AUG CUA GCU AUC GAU CGA UCG AA: Met (Start) Leu Ala lle Asp Arg Ser tRNA: UAC GAU CGA UAG CUA GCU AGC mRNA: AUG UGC AUA GAA CCG AUC GAU AA: Met (Start) Cys lle Glu Pro lle Asp tRNA: UAC ACG UAU CUU GGC UAG CUA

Mutations A permanent change that occurs in a cell’s DNA is called a mutation Types of gene mutations Point mutation or substitution missense, silent and nonsense Insertion causes frameshift Deletion

Mutations Types of chromosome mutations Deletion Duplication Inversion Translocation

Gene Mutations

Gene Mutations

Chromosome Mutations

Causes of Mutation Can occur spontaneously Chemicals and radiation also can damage DNA High-energy forms of radiation, such as X rays and gamma rays, are highly mutagenic

Body-Cell vs. Sex-Cell Mutation Somatic cell mutations (body cells) are not passed on to the next generation Mutations that occur in sex cells (gametes-sperm and egg) are passed on to the organism’s offspring and will be present in every cell of the offspring