Gene transfer to plants – vectors and strategies

Slides:

Advertisements

Similar presentations

Recombinant DNA prepare foreign (target) DNA prepare vector (host)

Advertisements

Section H Cloning Vectors

Plant Genetic Transformation. All stable transformation methods consist of three steps: Delivery of DNA into a single plant cell. Integration of the DNA.

Genetic Engineering of Plants BIT 220 End of Chapter 22.

Cloning Promoters Kelli Henry April 27, 2009.

Ti plasmid derived vector system

Chapter 4: recombinant DNA

Restriction Mapping.

PCR Product Orientation Test T7 EcoRI Cloning Site EcoRI PmeI PstI SpeI NotI pCR4-TOPO T7.

1 Trends in Biotechnology TB 09 Basic tools of recombinant DNA.

Cloning and Vector Chapter 3 Instructor : Prof. Myoung-Dong Kim T: 6458, Room 411, Ag. Bld #3.

Transformation/Transfection

CHAPTER 4 DNA CLONING (cont.) MISS NUR SHALENA SOFIAN.

Bacterial Transformation RET Summer Overall Picture Bio-Rad pGLO Transformation Insertion of GFP gene into HB101 E. coli.

Restriction mapping revision

Analysis of Transgenic Plants. 1.Regeneration on Selective Medium Selectable Marker Gene.

Recombinant DNA & Biotechnology. Recombinant DNA recombinant DNA molecules contain DNA from different organisms –any two DNAs are joined by DNA ligase.

Genetic Engineering and Recombinant DNA

Methods for Plant Gene Cloning Heterologous PCR Differential Hybridization Reverse Genetics: Antibody, PCR w/guessmers Gene tagging: promoter, inactivation,

Cloning and rDNA (II) Dr. Abdulaziz Almalik

Section H Cloning Vectors.

TOPICS IN (NANO) BIOTECHNOLOGY Lecture 6 30th October, 2006 PhD Course.

Chapter 18-Genetic Engineering of Plants: Methodology

PLANT VECTORS REKHA PULICHERLA

Vectors Timothy G. Standish, Ph. D.. Vectors If a fragment of DNA is ligated into an appropriate vector, it can be inserted into cells which will then.

Genetic Technologies Manipulating & Cloning DNA.

Cloning Vectors Section H H1 Design of plasmid vectors H2 Bacteriophage vectors H3 Cosmids H4 YAC H5 Eukaryotic vectors.

Lecture 7 Manipulation of foreign gene and secretion of foreign protein.

Cloning Genes Gene cloning: amplifying a specific piece of DNA via a bacteria cell Cloning vector: a replicating DNA molecule attached with a foreign DNA.

Plant Tissue Culture collection of techniques used to maintain or grow plant cells, tissues, or organs under sterile conditions mostly used to produce.

Relationship between Genotype and Phenotype

Genetic Engineering. Clip clips.

Supplement to Figure 1 Cloning steps involved in the construction of the bidirectional T-DNA/Ds gene traps. A KpnI fragment from pSK200 (Kumar and Narayanan,

8.1 - Manipulating & Cloning DNA

Gene delivery techniques

Cell Transformation Recombinant DNA Host Cell DNA Target gene Modified Host Cell DNA.

Molecular Cloning. Definitions   Cloning :   Obtaining a piece of DNA from its original source (Genome) and introducing it in a DNA vector   Sub-cloning:

B. Tech. (Biotechnology) III Year V th Semester

Steps to Recombinant DNA 1) Isolate the foreign DNA fragment 2) Attach DNA fragment to a “vehicle” called a Vector 3) Transfer the vector into a host.

Bacterial Transformation Green Fluorescent Protein.

Genetic Engineering of Plants Must get DNA: 1.into the cells 2.integrated into the genome (unless using transient expression assays) 3.expressed (everywhere.

Plant transformation Introduction of individual gene(s) of interest into plant genome Genetic modification with or without integration May include regeneration.

Dr. A.K. Saha Professor Department of Zoology University of Rajshahi

Recombinant DNA and Gene Cloning

Topics to be covers Basic features present on plasmids

E.Coli AS MODERN VECTOR.

2470 bp 1891 bp WT bp 2314 bp A B Fig. S1. Verification with PCR amplification of the.

Molecular Genetic Analysis and Biotechnology

Fac. of Agriculture, Assiut Univ.

Fundamental of Biotechnology

Supplementary Figure 1: Schematic representation of plasmid and strain construction. (a) Construction of the expression vectors for RedStar2, xylanase,

Plant Genetic Transformation

Chapter 10 – Genetic Engineering of Plants: Methodology

GUS AND GFP ANALYSIS IN HAIRY ROOTS OF

Vectors Dr Muhammad Imran.

13-3 Cell Transformation Interactive pgs. 329.

Bacterial Transformation

Restriction Enzymes and Plasmid Mapping

Genetic Transformation of Plants: Methods and Approaches to

RB LB D1 D1 VirD1 nicks RB / LB 5’ 3’ RB LB D2

Relationship between Genotype and Phenotype

Restriction Challenge

Molecular Biology Restriction enzymes.

“The natural genetic engineer”

Volume 8, Issue 4, Pages (October 2003)

Volume 7, Issue 12, Pages (December 2014)

E.Coli AS MODERN VECTOR.

Presentation transcript:

Gene transfer to plants – vectors and strategies Bio4600

Methods of transformation: Particle bombardment: Small particles covered with DNA are introduced into plant cells Whole plants are regenerated from transformed cells by tissue culture

Particle bombardment: Integration of many and often rearranged copies of foreign DNA in replicating regions

Methods of transformation: Agrobacterium tumefaciens-mediated transformation Utilization of a natural gene transfer system Introduction in flowering plants or plant cells Dicotyledonous plants

A. tumefaciens transformation of plant cells Ti-plasmid with T-DNA transfer of single-stranded T-DNA random integration

Selection of transformants and generation of transfomed plants

General requirements to a T-DNA vector pVS1 Sm/SpR LB pnos nptII 3’nos RB pKOH110- (10813bp +) EcoRI SmaI XbaI SscSJ87I HindIII Right and Left Borders E. coli origo A. tumefaciens origo Bacterial selectable marker Plant selectable marker Cloning sites Plasmid with vir-genes in A. tumefaciens strain

Vector for promoter analysis SmaI BamHI XbaI SalI PstI HindIII CCCGGGGATCCTCTAGAGTCGACCTGCAGGCTGCAAGCTT nos- ter gus nptII LB StrR, SmR RB pZP221G Vector backbone - 6160 bp ori pVS1 pBR322 bom rep NheI ClaI

Vector for over-expression and GFP detection PstI SmaI BamHI NotI XhoI EcoRI CmR ccdB BglII XbaI EcoRI attR1 PstI TL 35S GAW-A GFP ter attR2 EcoRI XbaI SscSJ87I HindIII RB pnos nptII pKOH35SGAWGFP 3’nos (ca. 14 kb) pVS1 LB Sm/SpR TL - translasjonsenhancer ter -terminator

Vector for knock-down, RNAi