Transcription and Translation

Slides:

Advertisements

Similar presentations

Transcription and Translation

Advertisements

13.3: RNA and Gene Expression

DNA Biology Lab 11. Nucleic Acids  DNA and RNA both built of nucleotides containing Sugar (deoxyribose or ribose) Nitrogenous base (ATCG or AUCG) Phosphate.

1. RNA vs. DNA RNADNA TThe sugar is RIBOSE UURACIL (U) is substituted for (T) Thymine AA=U CC=G RRNA is a single stranded chain of nucleotides.

TTAAGCGCTAATCGTACT Agenda Bell work #30

RNA & Protein Synthesis.

Protein Synthesis 6C transcription & translation.

Protein Synthesis Transcription. DNA vs. RNA Single stranded Ribose sugar Uracil Anywhere Double stranded Deoxyribose sugar Thymine Nucleus.

RNA and Protein Synthesis

3 types:  mRNA – used in transcription  tRNA – used in translation  rRNA – makes up ribosomes Composed of nucleotides  5 carbon sugar = ribose  phosphate.

12-3 RNA and Protein Synthesis

T RANSCRIPTION & T RANSLATION. C ENTRAL D OGMA Information flows in one direction from DNA to RNA to proteins. This is known as the central dogma.

Transcription and Translation. Protein Structure  Made up of amino acids  Polypeptide- string of amino acids bonded together (peptide bonds) Enzymes.

Structure of DNA DNA is made up of a long chain of nucleotides

DAY 1. Journal Questions A question given to you every few days To be checked on Tuesdays during Eagle time – Mrs. Nedrow and Mrs. Mahan’s class go to.

Transcription and Translation. Central Dogma of Molecular Biology  The flow of information in the cell starts at DNA, which replicates to form more DNA.

Transcription, Translation & Protein Synthesis Do you remember what proteins are made of ?  Hundreds of Amino Acids link  together to make one Protein.

DAY 2. Warm Up What type of RNA copies DNA? – mRNA What is this process called? – Transcription.

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

Unit 3.1 – Protein Synthesis. DAY 1 Journaling Question: Why is the gene that gives your freckles in your skin, not expressed in your pancreas?

Do Now  Turn in homework 3.2.1: due in first 2 minutes and no later  What are the 4 bases of DNA?  Which bases pair with each other?  What is the monomer.

Chapter – 10 Part II Molecular Biology of the Gene - Genetic Transcription and Translation.

DO Now- 2/27 Blonde hair is dominant to blonde hair. A heterozygous female is crossed with a heterozygous male… Punnett’s Square and phenotype/genotype.

RNA and Protein Synthesis

PROTEIN SYNTHESIS.

Protein Synthesis BLI.

DNA Replication.

The Central Dogma Transcription & Translation

Transcription and Translation

12.3 KEY CONCEPT Transcription converts DNA into a single-stranded RNA molecule. DNA can not leave nucleus..RNA CAN!

How to Make a Protein?.

Protein Synthesis.

Protein Synthesis.

From DNA to Proteins Transcription.

Agenda 4/23 and 4/24 DNA replication and protein synthesis review

TRANSCRIPTION AND TRANSLATION

RNA and Protein Synthesis

Protein Synthesis.

Transcription and Translation

Protein Synthesis.

Transcription and Translation

Transcription and Translation

Transcription and Translation

12-3 RNA and Protein Synthesis

Transcription Chapter 10 Section 1a.

Transcription and Translation

Biology Chapter 10 Section 1 Part 2

TRANSCRIPTION VERSUS TRANSLATION

Overview of Protein Synthesis And RNA Processing

From Genes to Proteins.

Transcription and Translation

Transcription and Translation

Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.

Transcription and Translation

13.1: RNA & Transcription.

Transcription and Translation

Transcription and Translation

RNA carries DNA’s instructions.

Transcription/ Translation Notes 16-17

GENE EXPRESSION / PROTEIN SYNTHESIS

From Genes to Proteins.

An Overview of Gene Expression

RNA, Protein Synthesis, Transcription, and Translation

DNA Transcription and Translation

Transcription and Translation

Protein Synthesis.

Protein Synthesis: An Overview

Protein Synthesis.

The Production of Proteins by DNA

Presentation transcript:

Transcription and Translation

Protein Structure Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different orders to make a variety of proteins Assembled on a ribosome

Replication DNA double helix unwinds DNA now single-stranded New DNA strand forms using complementary base pairing (A-T, C-G) Used to prepare DNA for cell division Whole genome copied/replicated

Transcription and Translation: An Overview (aka the Central Dogma)

RNA vs. DNA DNA Double stranded Deoxyribose sugar Bases: C,G A,T RNA Single stranded Ribose sugar Bases: C,G,A,U Both contain a sugar, phosphate, and base.

Transcription RNA forms base pairs with DNA C-G A-U

TRANSCRIPTION ACGATACCCTGACGAGCGTTAGCTATCG UGC UAU GGG ACU

Major players in transcription mRNA- type of RNA that encodes information for the synthesis of proteins and carries it to a ribosome from the nucleus

Major players in transcription RNA polymerase- complex of enzymes with 2 functions: Unwind DNA sequence Produce primary transcript by stringing together the chain of RNA nucleotides

mRNA Processing DNA sequence has coding regions (exons) and non-coding regions (introns) Introns must be removed before primary transcript is mRNA and can leave nucleus

Transcription is done…what now? Now we have mRNA transcribed from the cell’s DNA. It is leaving the nucleus through a nuclear pore. Once in the cytoplasm, it finds a ribosome so that translation can begin.

Translation Second stage of protein production mRNA is on a ribosome

Ribosomes 2 subunits, separate in cytoplasm until they join to begin translation Large Small

Translation Second stage of protein production mRNA is on a ribosome tRNA brings amino acids to the ribosome

tRNA Transfer RNA Bound to one amino acid on one end Anticodon on the other end complements mRNA codon

tRNA Function Amino acids must be in the correct order for the protein to function correctly tRNA lines up amino acids using mRNA code

Reading the DNA code Every group of 3 mRNA bases encodes a single amino acid Codon- coding triplet of mRNA bases

Transcription vs. Translation Review Process by which genetic information encoded in DNA is copied onto messenger RNA Occurs in the nucleus DNA mRNA Translation Process by which information encoded in mRNA is used to assemble a protein at a ribosome Occurs on a Ribosome mRNA protein