from nucleic acid language to amino acid language to PROTEIN language Translation from nucleic acid language to amino acid language to PROTEIN language https://learn.genetics.utah.edu/content/basics/firefly/

How does mRNA code for proteins? The ORDER of the nucleotide bases!!!!!! TACGCACATTTACGTACGCGG DNA 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? Met Arg Val Asn Ala Cys Ala Amino acid chain forms protein 20 How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Amino acid Met Arg Val Asn Ala Cys Ala protein

The code Code for ALL life! Code is redundant The wobble base allows strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” use M-RNA The wobble base allows room for MUTATIONS Why is the wobble good? Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

How are the codons matched to amino acids? 3 5 DNA TACGCACATTTACGTACGCGG 5 mRNA AUGCGUGUAAAUGCAUGCGCC 3 codon 3 5 UAC Met GCA Arg tRNA CAU Val anti-codon amino acid https://highered.mheducation.com/sites/9834092339/student_view0/chapter15/protein_synthesis.html

DNA mRNA protein trait From gene to protein nucleus cytoplasm aa From gene to protein The STRUCTURE and FUNCTION of the protein depends on the order of the amino acid sequences nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon Structure ribosomal RNA (rRNA) & proteins 2 subunits large small E P A http://learn.genetics.utah.edu/content/basics/transcribe/ http://lab.concord.org/embeddable.html#interactives/sam/DNA-to-proteins/4-mutations.json

Can you tell the story? RNA polymerase DNA amino acids tRNA pre-mRNA exon intron tRNA pre-mRNA mature mRNA 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit ribosome