Agarose gel electrophoresis illustrating randomly amplified polymorphic DNA (RAPD) fingerprints of the four reference strains and 12 tick isolates produced.

Slides:

Advertisements

Similar presentations

Characterization of the protein recognized by the monoclonal antibody D6 specific for Borrelia garinii isolates 1 O. Péter*, 1 J-C. Wyss, 1 A.G.Bretz,

Advertisements

Abstract Results Borrelia burgdorferi in Ixodes scapularis adult female ticks, Wisconsin Alyssa Kruger & Dr. Lloyd Turtinen Department of Biology.

©2001 Timothy G. Standish Romans 5:17 17For if by one man’s offence death reigned by one; much more they which receive abundance of grace and of the gift.

Biotechnology. Comparative genomics also has been used to identify recently mobilized transposons in genetically diverse humans. For example, over 600.

POLYMERASE CHAIN REACTION AMPLIFYING DNA What do you need to replicate DNA? umZT5z5R8.

Amplifying DNA. The Power of PCR View the animation at

5‘- AGAGTTTGATCCTGGCTCAG - 3’ 1492R 5'- GGTTACCTTGTTACGACTT - 3’ 785F

The microbial world S. Cerevisiae (yeast) Mycobacterium tuberculosis.

MOLECULAR GENETIC CHARACTERIZATION OF DAHLEM RED LAYERS MOLECULAR GENETIC CHARACTERIZATION OF DAHLEM RED LAYERS Ch.Shivaprasad Assistant Professor (AGB)

M Gradient PCR using Taq polymerase with 125ng primer concentration M: 1 kb ladder 1: 60°C 2: 62°C 3: 64.4°C 4:66.8°C 5: 69.2°C 6:71.5°C 284D.

Development of a specific detection assay to investigate growth and survival of BCAs in the field & Field trials of a potential BCA in Vietnamese rice.

Random Amplified Polymorphic DNA RAPD

MOLECULAR DETECTION AND IDENTIFICATION OF POTENTIAL PROBIOTIC LACTIC ACID BACTERIA ISOLATED FROM FERMENTED OLIVES Saxami Georgia1, Panagou Efstathios2,

Supplemental Figure 2. (A) AtplaIVA-1 and AtplaIVA-2 null transcription lines for AtPLAIVA mRNA. RNAs from the relevant wild type Col were isolated.

Detection of Borrelia afzelii, Borrelia burgdorferi sensu stricto, Borrelia garinii and group VS116 by PCR in skin biopsies of patients with erythema.

Suppression by an h Current of Spontaneous Na+ Action Potentials in Human Cone and Rod Photoreceptors Invest. Ophthalmol. Vis. Sci ;46(1):

A. Doménech-Sánchez, C. Juan, J.L. Pérez, C.I. Berrocal

Gradient PCR using Taq polymerase with 125ng primer concentration

How are areas of DNA that don’t code for proteins (genes) used by our cells? How can we make use of these areas?

A. Doménech-Sánchez, C. Juan, J.L. Pérez, C.I. Berrocal

A Rapid Polymerase Chain Reaction-Based Screening Method for Identification of All Expanded Alleles of the Fragile X (FMR1) Gene in Newborn and High-Risk.

Activity of quinupristin–dalfopristin in invasive isolates of Streptococcus pneumoniae from Italy A. Pantosti, F. D'Ambrosio, E. Bordi, A. Scotto d'Abusco,

Association of distinct species of Borrelia burgdorferi sensu lato with neuroborreliosis in Switzerland Olivier Péter, Anne-Gabrielle Bretz, Danièle.

Prevalence of diarrheagenic Escherichia coli strains detected by PCR in patients with travelers' diarrhea M. Vargas, J. Gascón, F. Gallardo, M. T. Jimenez.

Acrodermatitis chronica atrophicans and serologic confirmation of infection due to Borrelia afzelii and/or Borrelia garinii by immunoblot Viviane A.

Demonstration of Helicobacter pylori by the four staining methods: (A) modified Giemsa, (B) anti-H pylori antibody immunostain, (C) modified McMullen's.

A PCR-based method to differentiate between Acinetobacter baumannii and Acinetobacter genomic species 13TU P.G. Higgins, H. Wisplinghoff, O. Krut, H.

Neonatal listeriosis in Algeria: the first two cases

Oligonucleotide sequences of polymerase chain reaction (PCR) primers and competitive templates. Oligonucleotide sequences of polymerase chain reaction.

Comparison of the banding patterns from randomly amplified polymorphic DNA PCR assays of sequential B pseudomallei isolates from each of the cases. Comparison.

Detection of Borrelia afzelii, Borrelia burgdorferi sensu stricto, Borrelia garinii and group VS116 by PCR in skin biopsies of patients with erythema.

Pulse field gel electrophoresis: Lane 1 Lamda marker; lanes 2 to 5 K pneumoniae isolates from cases 3 to 6; lane 6 isolate from case 7; lane 7 ESBL negative.

Rhodococcus equi pneumonia in a heart transplant recipient in Korea, with emphasis on microbial diagnosis S.J. Yoo, H. Sung, J.D. Chae, M. -N. Kim, C.H.

Lyme borreliosis caused by diverse genospecies of Borrelia burgdorferi sensu lato in northeastern China X.-B. Ni, N. Jia, B.-G. Jiang, T. Sun, Y.-C.

Isolation and characterisation of toxin A-negative, toxin B-positive Clostridium difficile in Dublin, Ireland D. Drudy, N. Harnedy, S. Fanning, R. O'Mahony,

Improved performance with saliva and urine as alternative DNA sources for malaria diagnosis by mitochondrial DNA-based PCR assays C. Putaporntip, P.

Distribution of rpoB mutations among multidrug-resistant Mycobacterium tuberculosis (MDRTB) strains from Thailand and development of a rapid method for.

M. Schwaiger, O. Péter, P. Cassinotti

Mismatch repair immunohistochemistry (MMR IHC).

Representative RAPD profiles from pools of H

Acrodermatitis chronica atrophicans and serologic confirmation of infection due to Borrelia afzelii and/or Borrelia garinii by immunoblot Viviane A.

An outbreak of skin and soft tissue infection caused by Mycobacterium abscessus following acupuncture S.-J. Koh, T. Song, Y.A. Kang, J.W. Choi, K.J.

Products seen by gel electrophoresis following two rounds of the multiplex herpesvirus PCR. The material in lanes 1–15 was derived from genital swabs.

Clinical Microbiology and Infection

Nosocomial listeria gastroenteritis in a newborn, confirmed by random amplification of polymorphic DNA H. Hof, R. Lampidis, J. Bensch Clinical Microbiology.

Identification of widespread, closely related Acinetobacter baumannii isolates in Portugal as a subgroup of European clone II G. Da Silva, L. Dijkshoorn,

Â. C. Volpini, M. J. Marques, S. Lopes dos Santos, G. L

Human isolates of Aeromonas possess Shiga toxin genes (stx1 and stx2) highly similar to the most virulent gene variants of Escherichia coli A. Alperi,

(A) 7-Deaza-2`-deoxyguanosine (deaza-dGTP) allows PCR of the human p16INK4A promoter because the specific 140 bp product (black arrow, 140) is clearly.

Identification of Three Species of Borrelia burgdorferi Sensu Lato (B

Rebecca J. Seward, Kevin J. Towner Clinical Microbiology and Infection

Comparison of one-tube multiplex PCR, automated ribotyping and intergenic spacer (ITS) sequencing for rapid identification of Acinetobacter baumannii

(A) Haematoxylin and eosin stained section of multicentric Castleman's disease in a human immunodeficiency virus (HIV) positive patient showing a high.

Gel electrophoresis of measles virus cDNA amplicons (HU2 control measles virus RNA) amplified under optimised reaction conditions. Gel electrophoresis.

(A) Non-isotopic in situ hybridisation of human papillomavirus type 16 (HPV-16). (A) Non-isotopic in situ hybridisation of human papillomavirus type 16.

PCR amplification of the ORF encoding the cytosolic p36 protein of M

Agarose gel electrophoresis of DNA extracted from EDTA and formic acid decalcified bone marrow trephine biopsies. Agarose gel electrophoresis of DNA extracted.

Fig. 4. Coilin phosphomutant displays differential RNA binding and degradation activities.Purified proteins were analyzed for RNase activity with total.

T2 weighted (T2W), FLAIR (fluid attenuated inversion recovery), and T1W images demonstrate severe head atrophy with ex vacuo dilatation of the frontal.

Comparative genomic expressive hybridisation detection and quantification. Comparative genomic expressive hybridisation detection and quantification. (A)

Genotyping the intron 22 XbaI A restriction fragment length polymorphism (RFLP) using long distance PCR (LD-PCR). Genotyping the intron 22 XbaI A restriction.

Sensitivity and specificity plots of human epididymis protein 4 (HE4) (A and B, respectively) and carbohydrate antigen 125 (CA-125) (C and D, respectively)

Schematic representation of Epstein-Barr virus (EBV) nuclear antigen 1 (EBNA1) transcripts derived from the four different promoters. Schematic representation.

Agarose gel electrophoresis illustrating randomly amplified polymorphic DNA (RAPD) fingerprints of the four reference strains and 12 tick isolates produced.

Combination of pulsed-field gel electrophoresis (PFGE) and single-enzyme amplified fragment length polymorphism (SAFLP) for differentiation of multiresistant.

Agarose gel electrophoresis of ribosomal RNA gene polymerase chain reaction (PCR) products using Borrelia afzelii (top) and B burgdorferi sensu stricto.

IFF1/RBR3 allelic variation in 23 different clinical isolates representing 11 clades of C. albicans (isolated from different countries in different body.

Reverse transcription (RT) in situ polymerase chain reaction (PCR) experiment using a single stranded biotinylated oligonucleotide probe for the detection.

In vivo interaction of SAF-1 transcription factor with VEGF promoter in MDA-MB-231 cells. In vivo interaction of SAF-1 transcription factor with VEGF promoter.

Representative results showing PCR amplification of DNA from stools using PCR primers amplifying (A) SFB sequences and expected to generate an SFB 139 bp.

Presentation transcript:

Agarose gel electrophoresis illustrating randomly amplified polymorphic DNA (RAPD) fingerprints of the four reference strains and 12 tick isolates produced with primer BB1, 3.5 U Taq DNA polymerase, 4 mM MgCl2, and 40 ng DNA. Three main RAPD fingerprints were obtained: B1 from reference strain Borrelia afzelii ACA-1 (lane 2) and tick isolates C7, E5, F2, F8, and J1 (lanes 7, 8, 12, 14, and 19, respectively); B2 from reference strains B garinii A57 (lane 3) and B garinii A60 (lane 5); and B3 from reference strain B burgdorferi sensu stricto Hb1 (lane 4) and tick isolates E8, E9, E10, G4, G5, G10, and H1 (lanes 9, 10, 11, 15, 16, 17, and 18, respectively). Agarose gel electrophoresis illustrating randomly amplified polymorphic DNA (RAPD) fingerprints of the four reference strains and 12 tick isolates produced with primer BB1, 3.5 U Taq DNA polymerase, 4 mM MgCl2, and 40 ng DNA. Three main RAPD fingerprints were obtained: B1 from reference strain Borrelia afzelii ACA-1 (lane 2) and tick isolates C7, E5, F2, F8, and J1 (lanes 7, 8, 12, 14, and 19, respectively); B2 from reference strains B garinii A57 (lane 3) and B garinii A60 (lane 5); and B3 from reference strain B burgdorferi sensu stricto Hb1 (lane 4) and tick isolates E8, E9, E10, G4, G5, G10, and H1 (lanes 9, 10, 11, 15, 16, 17, and 18, respectively). Lane 6 contains negative control (distilled water) and lanes 1 and 13 contain a 123 bp ladder. C L Ling et al. Mol Path 2000;53:94-98 ©2000 by BMJ Publishing Group Ltd and Association of Clinical Pathologists