Figure 1a. Insertion of sequence into Claudi capsid gene Domain 1, HK97-Like Capsid Fold Domain 2, Probability: 69.8, E-value: 9.2E-4 Bacterial Ig-like domain, group 2 KongoTrouble Phamerator map image of Claudi capsid protein (gene 31) region compared to KongoTrouble (gene 27). Claudi capsid is missing its Big2 domain (dotted line) due to insertion of sequence into the capsid gene. Domain labels are from HHPred. Claudi

Fig 1b. Insertion of sequence into Claudi capsid gene KT: 14053 KT: 14054 232 bp INSERTION TTAATATAA C: 14362 C: 14594 Insertion in Claudi capsid gene. Alignment of KongoTrouble and Claudi capsid gene sequences shows a 6-nucleotide repeat (AAAAGG) is present on either side of the inserted nucleotide sequence. The insertion includes a stop codon (in red) that allows translation to stop after completion of the HK97-like domain. Coding potential from Genemark is shown below each domain, showing the Big2 domain has high coding potential but no start codon.

Fig 1c. Alignment of insertion sequence 97% identity to Bacillus Prophage Insertion, 232 bp Claudi gp 31 ATTGAAATGACAAATGTTTACAATCCAAAAGGTTAATATAA gp 32 AAAAGGT- - ATACTGGAATTACTTCTA KongoTrouble ATTGAAATGACAAATGTTTACAATCCAAAAGGTCTATACTGGAACTACTTCTA gp 27 Potential mechanism of recombination for Claudi capsid gene. Sequence alignment includes alignment of the 6-nucleotide repeat sequence into a structure that might be recognized by a recombination enzyme.

Fig 2a. Insertion of gene into SerPounce genome Gene 44 has been inserted into SerPounce’s genome Blasting SerPounce against itself has shown a 77 bp repeat on either side of the gene Possible insertion mechanism Purple shading is due to the first insertion in SerPounce being identical to the a sequence in KongoTrouble Orange shading shows a near to identical match of the second repeat with the same sequence in KongoTrouble KongoTrouble SerPounce

Fig 2b. Insertion of gene into SerPounce genome Gene 44, 30% Identity with Listeria Phage Insertion SerPounce 77 bp repeat Gene 43 ATCCCCTTTATGATTGTTTTAGTTGTTTTCTTAACCTATAATTATTATATCATTTATGTGTTAAATCGTCAATAGAT KongoTrouble ATCCCCTTT-TG-TTGTTTTAGTTGTTTT-TTAACCTATAATTATTATAACATTTATGTGTTAAATCGTCAATAGAT Gene 40 ATCCCCTTTATGATTGTTTTAGTTGTTTTCTTAACCTATAATTATTATATCATTTATGTGTTAAATCGTCAATAGAT Visualization of SerPounce Gene 44 Insertion This protein isn’t in any other phage in the database. SerPounce gp44 doesn’t have Bacillus or Bacillus phage homologs. Best matches are to Listeria phage protein.

Missing second (incomplete) domain Has complete domain Sequence used, Claudi gene 31 and space till gene 32 (query) compared to ViolettaMad gene 16 (subject) Claudi is on top in blue and Violettamad is on the bottom in red Red bar show the similar sequence between the two genomes Above we see a that there was an insertion in the Claudi gene 31, creating a break in the red bar. The rest of the original gene is downstream show again in red.

Note, difference in protein sequence highlighted in orange. Claudi capsid protein has a missing domain, as seen when compared to the VIolettaMad above.

Panel B Insertion Mechanism Draft Gap sequence completely found in Claudi and SerPounce Genome Rest of hits are in Bacillus family How is this a mechanism? Ask Allison Claudi Gap results in blastn with repeats has a lot of hits look at pdf on wiki

Panel C Draft Sequence used, Claudi gene 31 and space till gene 32 (query) compared to KongoTrouble gene 27 (subject) Claudi is on top in blue and KongoTrouble is on the bottom in red Red bar show the similar sequence between the two genomes Above we see a that there was an insertion in the Claudi gene 31, creating a break in the red bar. The rest of the original gene is downstream show again in red. Results for blasting Claudi gap against KongoTrouble gene Complete gene domain is only found in the podoviruses (phamerator)

Panel D Someone is making an image or something here.