Construction of the Tet-CD19CAR vector and surface CAR expression of Tet-CD19CAR–transduced SUP-T1 cells. Construction of the Tet-CD19CAR vector and surface.

Slides:

Advertisements

Similar presentations

Retrovirally Transduced CD34++ Human Cord Blood Cells Generate T Cells Expressing High Levels of the Retroviral Encoded Green Fluorescent Protein Marker.

Advertisements

Volume 19, Issue 2, Pages (February 2011)

Volume 12, Issue 5, Pages (November 2005)

Volume 15, Issue 6, Pages (June 2007)

Figure 1. Overexpression of PD-1 decoy increases IFN-γ secretion from T cells. Activated B6 splenic T cells were transduced with retrovirus carrying either.

Functional Expression and Analysis of a Human HLA-DQ Restricted, Nickel-Reactive T Cell Receptor in Mouse Hybridoma Cells Jörg Vollmer, Hans Ulrich Weltzien,

Anti-CD40 and CpG induce activation of T cells in draining lymph nodes

The supernatants of necrotic cells that cause dendritic cell maturation contain HMGB1. The supernatants of necrotic cells that cause dendritic cell maturation.

Melanoma donor (MD) NK cells are functionally impaired/exhausted.

A B C Supplementary Figure 1 Group 1 Group 2 Group 3 #1 #2 #3 #4 #5 #6

Phase 1 studies of central memory–derived CD19 CAR T–cell therapy following autologous HSCT in patients with B-cell NHL by Xiuli Wang, Leslie L. Popplewell,

Anti–4-1BB/PD-1 combination enriched CD8+ T cells in TILs

Volume 25, Issue 3, Pages (March 2017)

Volume 24, Issue 7, Pages (July 2016)

by Parisa Asvadi, Zohra Ahmadi, and Beng H. Chong

Volume 134, Issue 1, Pages (January 2008)

Volume 17, Issue 8, Pages (August 2009)

Volume 15, Issue 1, Pages (January 2007)

FLT3 internal tandem duplication mutations associated with human acute myeloid leukemias induce myeloproliferative disease in a murine bone marrow transplant.

Variable levels of cell surface and intracellular marker expression by HuT78 and HuT102 cells. Variable levels of cell surface and intracellular marker.

Suppressive effect of CD39+CD73+ melanoma cells on T-cell proliferation, and reversion of this effect via treatment with the CD39-blocking antibody, CD39.

A, RT-qPCR of ROR1 mRNA expression in B-CLL cells and a panel of human and rhesus macaque tissues. A, RT-qPCR of ROR1 mRNA expression in B-CLL cells and.

Volume 10, Issue 1, Pages (July 2004)

Enhanced sensitivity to inhibition of SHP2, STAT5, and Gab2 expression in chronic myeloid leukemia (CML)‏ by Michaela Scherr, Anuhar Chaturvedi, Karin.

A atgaagacagtgactggacctttgttcctgtgcttctggctgcagctgaactgtgtgagcagaggcgagcaggtggagcagcgccctcctcacctgagtgtccgggagggagacagtgccgttatcatctgcacctacacagaccctaacagttattacttcttctggtacaagcaagagccgggggcaggtcttcagttgcttatgaaggttttctcaagtacggaaataaacgaaggacaaggattcactg

Caspase-1 from myeloid cells induces tumor proliferation via MyD88 oncogenic signaling. Caspase-1 from myeloid cells induces tumor proliferation via MyD88.

The absence of ADCC by nivolumab in vitro.

Volume 9, Issue 4, Pages (April 2004)

Control of HIV Infection In Vivo Using Gene Therapy with a Secreted Entry Inhibitor Alexander Falkenhagen, Jastaranpreet Singh, Sabah Asad, Danila Leontyev,

Volume 23, Issue 4, Pages (April 2015)

Flow cytometry analysis of TNF-β- and IL-10-producing CD33+ cells.

Molecular Therapy - Nucleic Acids

Volume 25, Issue 11, Pages (November 2017)

Kailin Xu, Hong Ma, Thomas J. McCown, Inder M. Verma, Tal Kafri

Engineering HIV-Resistant, Anti-HIV Chimeric Antigen Receptor T Cells

Volume 19, Issue 2, Pages (February 2011)

Live and Let Die: A New Suicide Gene Therapy Moves to the Clinic

Volume 16, Issue 4, Pages (April 2008)

Generation and molecular characterization of LV producer cell lines

Volume 11, Issue 6, Pages (June 2005)

Volume 17, Issue 6, Pages (June 2009)

Exosome-mediated inhibition of T cells is reversible.

Molecular Therapy - Nucleic Acids

Functional characterization of CD4+ T-cells with various antigen specificities after transduction with FoxP3. Functional characterization of CD4+ T-cells.

Volume 8, Issue 1, Pages (July 2003)

Volume 23, Issue 4, Pages (April 2015)

Dox titration and kinetic analyses of CD19CAR expression upon Dox administration and discontinuation. Dox titration and kinetic analyses of CD19CAR expression.

Dox administration was required for Tet-CD19CAR T cells to show a suppressive function against a CD19+ tumor in vivo. Dox administration was required for.

KIR-CARs/Dap12 trigger robust antigen-specific cytotoxicity in vitro.

Fig. 1 Engineered T cells: design of TCR versus CAR T cells.

Colony-forming capacity of CD34+ cells with and without CLL-1 expression. Colony-forming capacity of CD34+ cells with and without CLL-1 expression. CD34+

Anti-CD20 CAR mRNA enhances exPBNK in vitro cytolytic activity against CD20+ B-NHL cells and rituximab-resistant cells. exPBNK were electroporated in the.

Kinetic of NFAT-CBR expression.

Melanoma patient monocytes have altered expression of inflammatory and surface markers. Melanoma patient monocytes have altered expression of inflammatory.

Ectopic expression of CA RSK1 mutant protects melanoma cells from PD98059-mediated apoptosis. Ectopic expression of CA RSK1 mutant protects melanoma cells.

Flow cytometry analysis of intracellular cytokine expression in control PBMC (left set of panels) and following either PMA-ionomycin activation (middle.

Uptake of TEX by DCs in vivo.

Expression of B7-H1, B7-DC, and PD-1 on B cells.

CD19-CAR-T cells with short and long spacers show specific in vitro function. CD19-CAR-T cells with short and long spacers show specific in vitro function.

Trametinib and combination promote moDC maturation and decrease moDC viability. Trametinib and combination promote moDC maturation and decrease moDC viability.

CD24 expression. CD24 expression. A, By global gene expression, CD24 is found to be highly upregulated in SEF (80×) and in LGFMS (37×) as compared with.

Monocytes from melanoma patients are unresponsive to TLR3 agonists.

Combination of R848 and anti-CD200R affects activation of tumor-infiltrating myeloid cells. Combination of R848 and anti-CD200R affects activation of tumor-infiltrating.

LSECtin, expressed by B16 cells, inhibits the tumor-specific immune responses both in vivo and in vitro. LSECtin, expressed by B16 cells, inhibits the.

LDL cholesterol inhibits Vγ9Vδ2 T-cell activation and cytokine production. LDL cholesterol inhibits Vγ9Vδ2 T-cell activation and cytokine production. Preexpanded.

T-cell expression of second-generation CARs

A Double-Switch Vector System Positively Regulates Transgene Expression by Endogenous microRNA Expression (miR-ON Vector) Mario Amendola, Alice Giustacchini,

EC-derived SP cells are targeted by CD30.CAR T cells.

Design and purification of CS1-NKG2D biAb by metal-affinity chromatography. Design and purification of CS1-NKG2D biAb by metal-affinity chromatography.

Expression of CAR, endogenous TCR, and target-cell receptors.

Presentation transcript:

Construction of the Tet-CD19CAR vector and surface CAR expression of Tet-CD19CAR–transduced SUP-T1 cells. Construction of the Tet-CD19CAR vector and surface CAR expression of Tet-CD19CAR–transduced SUP-T1 cells. A, schematic representation of the Tet-CD19CAR construct. CD19CAR consisted of anti-CD19 scFv linked to CD3ζ, a CD28 costimulatory domain, and a truncated EGFR (tEGFR), which was used as a transduction or selection marker, via the T2A sequence. The Tet-On 3G transactivator is oriented in the forward direction downstream of the human phosphoglycerate kinase 1 promoter (p-hPGK), and CD19CAR is transcribed in the reverse orientation under the pTRE3G promoter, which contains the Tet-response element. LTR, long terminal repeat; WPRE, Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element. B, SUP-T1 cells were transduced with the Tet-CD19CAR–encoding retroviral supernatant. tEGFR+ cells were then purified using flow cytometry with a cell sorter. C, after sorting, the tEGFR was stained with biotinylated erbitux, used as a transduction marker (left), and surface CD19CAR was stained with an anti-Fc Ab in the presence (solid line) or absence (dashed line) of Dox. Gray histograms show staining of unmodified SUP-T1 cells (B and C). Reona Sakemura et al. Cancer Immunol Res 2016;4:658-668 ©2016 by American Association for Cancer Research