KDM4A SNP-A482 (rs586339) correlates with worse outcome in patients with NSCLC. A, schematic of the human KDM4A protein is shown with both the protein.

Slides:



Advertisements
Similar presentations
Julia Krushkal 4/11/2017 The International HapMap Project: A Rich Resource of Genetic Information Julia Krushkal Lecture in Bioinformatics 04/15/2010.
Advertisements

Are you ready for the genomic age? An introduction to human genomics Jacques Fellay EPFL School of Life Sciences Swiss Institute of Bioinformatics Lausanne,
Genome-wide Association Study Focus on association between SNPs and traits Tendency – Larger and larger sample size – Use of more narrowly defined phenotypes(blood.
Single Nucleotide Polymorphism And Association Studies
Understanding GWAS Chip Design – Linkage Disequilibrium and HapMap Peter Castaldi January 29, 2013.
Workshop in Bioinformatics Eran Halperin. The Human Genome Project “What we are announcing today is that we have reached a milestone…that is, covering.
Two loci AA/AA x BB/BB AB/AB (F1) AA AA long chrom short chrom locus 1 locus 2 Parent A BB BB long chrom short chrom locus 1 locus 2 Parent B Locus1/Locus.
Welcome to CS374! A survey of computer science in genomics today ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG.
Course Overview Personalized Medicine: Understanding Your Own Genome Fall 2014.
HapMap: application in the design and interpretation of association studies Mark J. Daly, PhD on behalf of The International HapMap Consortium.
Medical variations Gabor T. Marth Boston College Biology Department BI543 Fall 2013 February 5, 2013.
Figure S1. Quantile-quantile plot in –log10 scale for the individual studies The red line represents concordance of observed and expected values. The shaded.
Molecular & Genetic Epi 217 Association Studies
Human Population Genomics ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG.
1 of 32 Sequence Variation in Ensembl. 2 of 32 Outline SNPs SNPs in Ensembl Haplotypes & Linkage Disequilibrium SNPs in BioMart HapMap project Strain-specific.
Introduction: Human Population Genomics ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG.
Introduction: Human Population Genomics ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG.
Molecular & Genetic Epi 217 Association Studies: Indirect John Witte.
Polymorphism Haixu Tang School of Informatics. Genome variations underlie phenotypic differences cause inherited diseases.
Recombination based population genomics Jaume Bertranpetit Marta Melé Francesc Calafell Asif Javed Laxmi Parida.
Epidemiology 217 Molecular and Genetic Epidemiology Bioinformatics & Proteomics John Witte, Xin Liu & Mark Pletcher.
Clustering and optimization in genetic data: the problem of Tag-SNPs selection Paola Bertolazzi, Serena D‘ Aguanno, Giovanni Felici *, Paola Festa** *
Supplementary Table 1.
The International Consortium. The International HapMap Project.
Motivations to study human genetic variation
Copyright OpenHelix. No use or reproduction without express written consent1.
Human Population Genomics
Population Genetics As we all have an interest in genomic epidemiology we are likely all either in the process of sampling and ananlysising genetic data.
Week 5 Theory and application for setting up an RNA-Seq pipeline
Differences in asthma genetics between Chinese and other populations
Itsik Pe’er, Yves R. Chretien, Paul I. W. de Bakker, Jeffrey C
Pulling out the 1%: Whole-Genome Capture for the Targeted Enrichment of Ancient DNA Sequencing Libraries  Meredith L. Carpenter, Jason D. Buenrostro,
Volume 4, Issue 3, Pages (September 2008)
Genome-Wide Association Study Identifies Risk Variants for Lichen Planus in Patients With Hepatitis C Virus Infection  Yumiko Nagao, Nao Nishida, Licht.
A Common 16p11.2 Inversion Underlies the Joint Susceptibility to Asthma and Obesity  Juan R. González, Alejandro Cáceres, Tonu Esko, Ivon Cuscó, Marta.
Volume 131, Issue 6, Pages (December 2007)
Tracing the Route of Modern Humans out of Africa by Using 225 Human Genome Sequences from Ethiopians and Egyptians  Luca Pagani, Stephan Schiffels, Deepti.
Michelle M. Stein, PhD, Emma E
Investigating the Association of Genetic Admixture and Donor/Recipient Genetic Disparity with Transplant Outcomes  Abeer Madbouly, Tao Wang, Michael Haagenson,
by Vagheesh M. Narasimhan, Karen A. Hunt, Dan Mason, Christopher L
Differences in asthma genetics between Chinese and other populations
HLA-DRA variants predict penicillin allergy in genome-wide fine-mapping genotyping  Jean-Louis Guéant, MD, PhD, Antonino Romano, MD, Jose-Antonio Cornejo-Garcia,
Typing of 111 ancestry informative markers in an Albanian population
Human subjects are protected from mast cell tryptase deficiency despite frequent inheritance of loss-of-function mutations  Neil N. Trivedi, MD, Bani.
Association of the CHRNA3 Locus with Lung Cancer Risk and Prognosis in Chinese Han Population  Xiaomin Niu, MD, Zhiwei Chen, MD, PhD, Shengping Shen,
Xuanyao Liu, Rick Twee-Hee Ong, Esakimuthu Nisha Pillai, Abier M
Polycystic ovary syndrome: an ancient disorder?
Genetic variation in chitinase 3-like 1 (CHI3L1) contributes to asthma severity and airway expression of YKL-40  Jose L. Gomez, MD, MS, Gina M. Crisafi,
Leslie S. Emery, Joseph Felsenstein, Joshua M. Akey 
Population Genetic Inference from Personal Genome Data: Impact of Ancestry and Admixture on Human Genomic Variation  Jeffrey M. Kidd, Simon Gravel, Jake.
Catarina D. Campbell, Nick Sampas, Anya Tsalenko, Peter H
Volume 380, Issue 9844, Pages (September 2012)
Volume 131, Issue 6, Pages (December 2007)
Identification and analysis of a SMAD3 cis-acting eQTL operating in primary osteoarthritis and in the aneurysms and osteoarthritis syndrome  E.V.A. Raine,
Molecular and Functional Studies of Tyrosinase Variants Among Indian Oculocutaneous Albinism Type 1 Patients  Moumita Chaki, Mainak Sengupta, Maitreyee.
Trevor J. Pemberton, Chaolong Wang, Jun Z. Li, Noah A. Rosenberg 
Human Diversity in a Cell Surface Receptor that Inhibits Autophagy
Xuanyao Liu, Rick Twee-Hee Ong, Esakimuthu Nisha Pillai, Abier M
Figure 3 Genotype-phenotype correlation in SPG7 mutations and age at onset of symptoms Genotype-phenotype correlation in SPG7 mutations and age at onset.
Yu Zhang, Tianhua Niu, Jun S. Liu 
Volume 152, Issue 8, Pages (June 2017)
Admixture Mapping of an Allele Affecting Interleukin 6 Soluble Receptor and Interleukin 6 Levels  David Reich, Nick Patterson, Vijaya Ramesh, Philip L.
Regional association plot of genotyped and imputed SNPs in proximity to rs , summarizing evidence of interaction with at least weekly heartburn or.
Kaplan–Meier curves for PFS and OS (for patients treated with anti-PD-1/PD-L1 monotherapy). Kaplan–Meier curves for PFS and OS (for patients treated with.
Comparison of variant associations from previous reports and results from the KP GWAS meta-analysis for 105 known prostate cancer risk SNPs. Plotted values.
Scatter plot of serum OPN levels and its correlation with patient survival. Scatter plot of serum OPN levels and its correlation with patient survival.
Cell-cycle regulatory proteins were controlled by O-GlcNAc at FOXO3 S284 through MDM2. Cell-cycle regulatory proteins were controlled by O-GlcNAc at FOXO3.
Integrated analysis of gene expression and copy number alterations.
KDM4A levels affect the distribution of translation initiation factors
Fig. 4 Neanderthal ancestry distribution in Eurasian populations.
Presentation transcript:

KDM4A SNP-A482 (rs586339) correlates with worse outcome in patients with NSCLC. A, schematic of the human KDM4A protein is shown with both the protein domains and the position of the coding SNP rs586339 (E482A). KDM4A SNP-A482 (rs586339) correlates with worse outcome in patients with NSCLC. A, schematic of the human KDM4A protein is shown with both the protein domains and the position of the coding SNP rs586339 (E482A). Jumonji (JmjN and JmjC), PHD, and Tudor (T) domains are represented. B, E482 is the conserved allele. The alignment of sequence surrounding E482A is shown for multiple species. C, HapMap frequencies for rs586339 are presented (August 2010 HapMap public release #28; ref. 13). ASW, African Ancestry in SW USA (n = 57); CEU, U.S. Utah residents with ancestry from northern and western Europe (n = 113); CHB, Han Chinese in Beijing, China (n = 135); CHD, Chinese in Metropolitan Denver, CO (n = 109); GIH, Gujarati Indians in Houston, TX (n = 99); JPT, Japanese in Tokyo, Japan (n = 113); LWK, Luhya in Webuye, Kenya (n = 110); MKK, Maasai in Kinyawa, Kenya (n = 155); MXL, Mexican Ancestry in Los Angeles, CA (n = 58); TSI, Toscani in Italia (n = 102); YRI, Yoruba in Ibadan, Nigeria (n = 147). D, representative KDM4A sequencing plots from three different lung cancer cell lines—homozygote wild-type (WT, GAA:GAA), heterozygote (HET, GAA:GCA), and homozygote SNP (A-482, GCA:GCA). E, KDM4A SNP-A482 stratification for patients with late-stage NSCLC. 95% CI, 95% confidence interval; P, the P value; n, the number of patients in each category; AA, the genotype for homozygote WT (E482); AC, the genotype for heterozygote; CC, the genotype for homozygote SNP (A482). Gray boxes, parameters with significance, including the data in Supplementary Fig. S1 (panels B–F). Frequency comparisons were tested using the χ2 test, and HRs were calculated using a Cox model. Also see Supplementary Fig. S1. Capucine Van Rechem et al. Cancer Discovery 2015;5:245-254 ©2015 by American Association for Cancer Research