Jason Yen-Ping Ho, M. D. , Weng Chi Man, Ph. D. , Yan Wen, M. D

Slides:

Advertisements

Similar presentations

Reduction of estrogen production by interleukin-6 in a human granulosa tumor cell line may have implications for endometriosis-associated infertility

Advertisements

Human chorionic gonadotropin controls luteal vascular permeability via vascular endothelial growth factor by down-regulation of a cascade of adhesion.

Tsai-Der Chuang, Ph.D., Omid Khorram, M.D., Ph.D.

Distinctive proliferative phase differences in gene expression in human myometrium and leiomyomata Hongbo Wang, MD, Mamatha Mahadevappa, PhD, Karen Yamamoto,

Down-regulation of HLA-G boosted natural killer cell-mediated cytolysis in JEG-3 cells cultured in vitro Li Li Sun, M.Sc., Yibing Han, Ph.D., Jian Hui.

Genome-based expression profiling as a single standardized microarray platform for the diagnosis of endometrial disorder: an array of 126-gene model

Increased expression of c-fos protein associated with increased matrix metalloproteinase-9 protein expression in the endometrium of endometriotic patients

Clinical significance of melatonin receptors in the human myometrium

Fertility and Sterility

Increased expression of platelet-derived growth factor C messenger ribonucleic acid in uterine leiomyomata Yuh-Ming Hwu, M.D., Sheng-Hsiang Li, Ph.D.,

Ibrahim Sozen, M.D., David L Olive, M.D., Aydin Arici, M.D.

Michael M. Alper, M.D. Fertility and Sterility

Curcumin, a nutritional supplement with antineoplastic activity, enhances leiomyoma cell apoptosis and decreases fibronectin expression Minnie Malik,

Composition of single-step media used for human embryo culture

Yu Wang, M. D. , Ph. D. , Yang Lv, Ph. D. , Liyan Wang, M. D

Ming-hui Chen, M. D. , Tao Li, Ph. D. , Chen-hui Ding, Ph. D

Ling Wu, M. Sc. , Aijun Zhang, Ph. D. , Yijuan Sun, Ph. D

Chakradhari Sharan, Ph. D. , Sunil K. Halder, Ph. D

Xian-Hua Lin, M. D. , Miao-E. Liu, M. B. , Hai-Yan Xu, M. B

Expression of insulin-like growth factors (IGFs) and IGF signaling: molecular complexity in uterine leiomyomas Lan Peng, M.D., Yong Wen, M.D., Yulong.

Zhen Tian, Ph. D. , Zhen-Ao Zhao, Ph. D. , Xiao-Huan Liang, Ph. D

Marta Busnelli, Ph. D. , Valeria Rimoldi, Ph. D. , Paola Viganò, Ph. D

Dienogest inhibits nerve growth factor expression induced by tumor necrosis factor-α or interleukin-1β Shizuka Mita, M.S., Yutaka Shimizu, Ph.D., Ayumi.

The antifibrotic drug halofuginone inhibits proliferation and collagen production by human leiomyoma and myometrial smooth muscle cells Meagan M. Grudzien,

Expression of microtubule associated protein 2 and synaptophysin in endometrium: high levels in deep infiltrating endometriosis lesions Martina Gori,

Regulation of myeloid ecotropic viral integration site 1 and its expression in normal and abnormal endometrium Linli Hu, M.D., Haixia Li, M.D., CindyTzu-Ling.

Expression of growth differentiation factor-9 and bone morphogenetic protein-15 in oocytes and cumulus granulosa cells of patients with polycystic ovary.

Myometrial cells undergo fibrotic transformation under the influence of transforming growth factor β-3 Doina S. Joseph, M.S., Minnie Malik, Ph.D., Sahadat.

Transforming growth factor (TGF)-β1-induced human endometrial stromal cell decidualization through extracellular signal-regulated kinase and Smad activation.

Tumor necrosis factor α up-regulates endometrial milk fat globule–epidermal growth factor 8 protein production via nuclear factor κB activation, resulting.

Impact of submucous myoma on the severity of anemia

Leiomyoma-derived transforming growth factor-β impairs bone morphogenetic protein-2- mediated endometrial receptivity Leo F. Doherty, M.D., Hugh S. Taylor,

Sana M. Salih, M. D. , Salama A. Salama, Ph. D. , Amin A. Fadl, Ph. D

Cell plating density alters the ratio of estrogenic to progestagenic enzyme gene expression in cultured granulosa cells Valério M. Portela, D.V.M., Ph.D.,

J. Browning Fitzgerald, B. S. , Vargheese Chennathukuzhi, Ph. D

Genome-based expression profiling as a single standardized microarray platform for the diagnosis of endometrial disorder: an array of 126-gene model

Antiviral responses of human Fallopian tube epithelial cells to toll-like receptor 3 agonist poly(I:C) Mimi Ghosh, Ph.D., Todd M. Schaefer, Ph.D., John.

Xiao-Yu Pan, Ph. D. , Xue Li, M. D. , Zhan-Ping Weng, Ph. D

Reply of the Authors Fertility and Sterility

Yan Wen, M. D. , Rudy Quintero, M. D. , Bertha Chen, M. D

Up-regulation of p21-activated kinase 1 by in vitro treatment with interleukin 1-beta and its increased expression in ovarian endometriotic cysts Mi.

Up-regulation of endocrine gland-derived vascular endothelial growth factor but not vascular endothelial growth factor in human ectopic endometriotic.

Composition of commercial media used for human embryo culture

Activating transcription factor 3 gene expression suggests that tissue stress plays a role in leiomyoma development Mark Payson, M.D., Minnie Malik,

Nonsense mutation of EMX2 is potential causative for uterus didelphysis: first molecular explanation for isolated incomplete müllerian fusion Shan Liu,

Adenovirus-mediated expression of cyclooxygenase-2 antisense reverse abnormal genetic profile of human adhesion fibroblasts Ghassan M. Saed, Ph.D., Ayman.

Rahi Victory, M. D. , F. R. C. S. C. , Ghassan M. Saed, Ph. D

Rodrigo Borsari, M. D. , Nilo Bozzini, Ph. D

Increased progesterone receptor expression in uterine leiomyoma: correlation with age, number of leiomyomas, and clinical symptoms Anastasia Tsigkou,

Management of tubal ectopic pregnancy: methotrexate and salpingostomy are preferred to preserve fertility Stephanie Beall, M.D., Ph.D., Alan H. DeCherney,

Jieqiang Lv, M. D. , Xueqiong Zhu, M. D. , Ph. D

Hypoxia regulates iNOS expression in human normal peritoneal and adhesion fibroblasts through nuclear factor kappa B activation mechanism Zhong L. Jiang,

Akanksha Mehta, M.D., Darius A. Paduch, M.D., Ph.D.

Granulosa–lutein cell growth differentiation factor-9 (GDF-9) messenger RNA and protein expression in in vitro fertilization (IVF) cycles: relation to.

Erica E. Marsh, M. D. , Zhihong Lin, Ph. D. , Ping Yin, Ph. D

Müllerian-inhibiting substance inhibits cytochrome P450 aromatase activity in human granulosa lutein cell culture Michael P. Grossman, M.D., Steven T.

Masaaki Iwahashi, M.D., Yasuteru Muragaki, M.D.

CDB-2914, a novel selective progesterone receptor modulator, differentially regulates endometrial gene expression in the proliferative phase of the menstrual.

Jui-Hung Chang, Ph. D. , Heng-Kien Au, M. D. , Wei-Chin Lee, M. S

Effect of leptin on prolactin and insulin-like growth factor-I secretion by cultured rat endometrial stromal cells Kamani H. Tennekoon, Ph.D., Thampoe.

Lin Mu, Ph. D. , Wei Zheng, Ph. D. , M. D. , Liang Wang, Ph. D

Effects of hyperglycemia on the differential expression of insulin and insulin-like growth factor-I receptors in human normal peritoneal and adhesion.

The serum follicle-stimulating hormone-to-luteinizing hormone ratio at the start of stimulation with gonadotropins after pituitary down-regulation is.

Expression of leucine-rich repeat-containing G-protein-coupled receptors in the human cyclic endometrium Claudia A. Krusche, Ph.D., Tina Kroll, Henning.

Upregulation of mRNA expression of vascular endothelial growth factor and its receptors by exogenous human chorionic gonadotropin in cultured oviduct.

Differences in gene expression in the proliferative human endometrium

Susanna McReynolds, Ph. D. , Monika Dzieciatkowska, Ph. D

William H. Catherino, M.D., Ph.D., Minnie Malik, Ph.D.

Ronald M. Yang, M. D. , Richard A. Fefferman, M. D. , Charles E

Kálmán A. Kovács, M. D. , Ph. D. , Ferenc Lengyel, Ph. D

Presentation transcript:

Transforming growth interacting factor expression in leiomyoma compared with myometrium Jason Yen-Ping Ho, M.D., Weng Chi Man, Ph.D., Yan Wen, M.D., Mary Lake Polan, M.D., Ph.D., Esther Shih-Chu Ho, M.D., Bertha Chen, M.D. Fertility and Sterility Volume 94, Issue 3, Pages 1078-1083 (August 2010) DOI: 10.1016/j.fertnstert.2009.05.001 Copyright © 2010 American Society for Reproductive Medicine Terms and Conditions

Figure 1 The expressions of TGIF mRNA are compared between myometrium and leiomyoma. After normalizing with the internal control gene HPRT-1, relative quantification of the gene TGIF was divided by one calibrator sample value to generate the relative quantification to calibrator average (Rel. Quant. to Cal. Avg.). (A) The secretory phase (n = 8, P=.01). (B) The proliferative phase (n = 8, P=.012). Western blot of TGIF protein levels in myometrium and leiomyoma. (C) TGIF showed a double band of 30–35 kd. M, myometrium; A, leiomyoma. (D) The secretory phase (n = 7, P=.01). (E) The proliferative phase (N = 7, P=.045). ∗Comparisons between myometrium and leiomyoma, paired t-test. Fertility and Sterility 2010 94, 1078-1083DOI: (10.1016/j.fertnstert.2009.05.001) Copyright © 2010 American Society for Reproductive Medicine Terms and Conditions

Figure 2 (A, B, C) TGIF protein and mRNA are statistically significantly increased by transfection with pCMV5 Flag TGIF plasmid compared with cells infected with control plasmid. (D) Overexpression of TGIF protein suppresses the PAI-1 up-regulation induced by TGF-β1. The transfected cells were cultured in serum-free medium for 16 hours before treatment with TGF-β1 (1 ng/mL). TGF-β1 induces PAI-1 up-regulation in cells transfected with control plasmid at 6 hours (P=.024, #). PAI-1 up-regulation is statistically significantly suppressed in cells transfected with TGIF plasmid (P=.002, @) compared with cells transfected with control plasmid. PAI-1 primer: forward: GTTACCCCCATGACTCCAGA, reverse: CGCAGACTTCTCACCAAACA. Fertility and Sterility 2010 94, 1078-1083DOI: (10.1016/j.fertnstert.2009.05.001) Copyright © 2010 American Society for Reproductive Medicine Terms and Conditions