(A) Bayesian phylogenetic tree of the H gene nucleotide alignment from tigers Pt2004 and Pt2010-3 and representative CDV sequences obtained from GenBank.

Slides:

Advertisements

Similar presentations

Maximum Likelihood. Historically the newest method. Popularized by Joseph Felsenstein, Seattle, Washington. Its slow uptake by the scientific community.

Advertisements

Multiple alignment June 29, 2007 Learning objectives- Review sequence alignment answer and answer questions you may have. Understand how the E value may.

Methods for Phylogenetics and Evolutionary analysis Jianpeng Xu University of Nebraska-Omah a.

Protein Sequence Classification Using Neighbor-Joining Method

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

Phylogenetic analyses Kirsi Kostamo. The aim: To construct a visual representation (a tree) to describe the assumed evolution occurring between and among.

Multiple Sequence Alignment May 12, 2009 Announcements Quiz #2 return (average 30) Hand in homework #7 Learning objectives-Understand ClustalW Homework#8-Due.

Partners in Prevention Jim Hughes in collaboration with, and many slides stolen from … Connie Celum Mary Campbell Jai Lingappa Gerry Myers Jim Mullins.

ZORRO : A masking program for incorporating Alignment Accuracy in Phylogenetic Inference Sourav Chatterji Martin Wu.

Phylogenetics and Coalescence Lab 9 October 24, 2012.

PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1.

Pairwise Sequence Analysis-III

Molecular Evolution. Study of how genes and proteins evolve and how are organisms related based on their DNA sequence Molecular evolution therefore is.

Substitution Matrices and Alignment Statistics BMI/CS 776 Mark Craven February 2002.

Students Adda Zachary Deema Al Ghanim Horsley Jacqueline Sandrick Daniel Mentors Xiaoming Gao Xinjun Zhang Thilina Gunarathne Supervised by Dr.Judy Qiu.

Unrooted phylogenetic tree showing the relationship between the human SLC2A gene family for all 14 members created using PHYLIP 3.6 softwareDistance between.

Sequence and structure relatedness of matrix protein of human respiratory syncytial virus with matrix proteins of other negative-sense RNA viruses K.

Goals of Phylogenetic Analysis

Molecular Evolution.

Multiple sequence alignment of S

Genes to Trees Daniel Ayres and Adam Bazinet

West Nile virus outbreak in Israel in 2015: phylogenetic and geographic characterization in humans and mosquitoes Y. Lustig, Z. Kaufman, B. Mannasse,

L. Dubourg Clinical Microbiology and Infection

A. Papa, K. Dumaidi, F. Franzidou, A. Antoniadis

Chapter 19 Molecular Phylogenetics

Schematic diagrams of genomic structure, the strategy for genomic cDNA cloning, and molecular characterization of unique features of three emergent U.S.

Ehrlichia canis phylogenetic analysis of the Borgo (Corsica) strain

A. Papa, K. Xanthopoulou, S. Gewehr, S. Mourelatos

Lack of phylogenetic conservatism of Bacillus anthracis plasmid copy number. Lack of phylogenetic conservatism of Bacillus anthracis plasmid copy number.

Multiple sequence alignment & Phylogenetics Analysis

Maximum-likelihood phylogenetic tree of norovirus genomes belonging to genogroup GI, with the norovirus GII reference genome as an outlier. Maximum-likelihood.

Where would you draw the polyA tail in the gene above?______________

Comparative phylogenetic analysis of sapoviruses based on complete RdRp and VP1 nucleotide sequences. Comparative phylogenetic analysis of sapoviruses.

Sequence and structure relatedness of matrix protein of human respiratory syncytial virus with matrix proteins of other negative-sense RNA viruses K.

Development of a real-time PCR assay for the specific detection and identification of Streptococcus pseudopneumoniae using the recA gene V. Sistek, M.

Phylogenetic tree of Leclercia spp

Maximum likelihood (ML) unrooted tree based on the full-length 16S rRNA genes (A) and 31 conserved single-copy genes (B) showing the phylogenetic position.

(A) Tiled view of an ESOM map constructed using all 51 metagenome bins assembled from the samples collected in this study, with the white square encompassing.

Phylogenetic tree based on 16S rRNA gene sequence comparisons over 1,260 aligned bases showing the relationship between species of the genus Actinomyces.

S. De Grazia, G.M. Giammanco, C. Colomba, A. Cascio, S. Arista

Phylogenetic tree showing generic and species positions based on Bayesian analysis of the nuclear ribosomal DNA 28S region (1,200 bp) of Schistosomatidae.

Phylogenetic tree of 38 Pseudomonas type strains, based on the V3-V5 region sequence of the 16S rRNA gene (V3 primer, positions 442 to 492; and V5 primer,

iraL shares sequence identity with iraM from E

Visualization of lineage radius increase.

Core genome phylogeny of V. anguillarum strains.

Phylogenetic analyses of alphacoronaviruses based on complete genome and ORF1ab protein sequence. Phylogenetic analyses of alphacoronaviruses based on.

Phylogenetic tree of 38 Pseudomonas type strains, based on a concatenated nine-gene MLST analysis. Phylogenetic tree of 38 Pseudomonas type strains, based.

Amino acid sequence homology between XLMO-2 and the mouse, human and zebrafish homologs. Amino acid sequence homology between XLMO-2 and the mouse, human.

Phylogenetic comparison among selected Pasteurella multocida and Haemophilus influenzae species with completed genome sequences. Phylogenetic comparison.

(a) Mycetoma aspect of the patient in the right forearm.

Phylogenetic analysis of AquK2P.

Phylogenetic analysis of K. quasipneumoniae subsp

Neighbor-joining tree of the 262 S

Genogroup and genotypes of GI, GII, GIII, GIV, and GV sapovirus strains based on complete VP1 nucleotide sequences. Genogroup and genotypes of GI, GII,

Positions of amino acids in NA that have changed since 2009.

Phylogenetic tree representation of a neighbor-joining analysis of several species of piroplasms. Phylogenetic tree representation of a neighbor-joining.

Characterization of SsPV1/WF-1 isolated from hypovirulent strain WF-1.

Geographical distribution (A) and historical information (B) for tigers in the Russian Far East that died or were killed due to abnormal neurologic behavior.

S protein sequence-based phylogenetic analyses of alphacoronaviruses.

Phylogenetic positions of the Fe hydrogenases of termite gut symbionts

Phylogenetic tree based on predominant 16S rRNA gene sequences obtained by C4–V8 Sutterella PCR from AUT-GI patients, Sutterella species isolates, and.

(A) Comparison of mcr-9 to all previously described mcr homologues, based on amino acid sequence. (A) Comparison of mcr-9 to all previously described mcr.

Molecular phylogenetic analysis of RNA polymerase II largest-subunit protein sequences from various trichomonads, including D. fragilis. Molecular phylogenetic.

Phylogenetic trees for fusion (F) and attachment (G) genes of selected HMPV isolates. Phylogenetic trees for fusion (F) and attachment (G) genes of selected.

Relationship of partial rpoB gene sequences inferred by the neighbor-joining method for Canadian study strains of C. pyruviciproducens. Relationship of.

Volume 53, Issue 4, Pages (October 2010)

Sequence alignment of colicin lysis proteins.

Differences in the relative abundances of mycobacteria (as determined via 16S rRNA gene sequencing) across households in the United States on municipal.

ADAGE extracted features that represented sequence differences between strains. ADAGE extracted features that represented sequence differences between.

Presentation transcript:

(A) Bayesian phylogenetic tree of the H gene nucleotide alignment from tigers Pt2004 and Pt2010-3 and representative CDV sequences obtained from GenBank. (A) Bayesian phylogenetic tree of the H gene nucleotide alignment from tigers Pt2004 and Pt2010-3 and representative CDV sequences obtained from GenBank. Sequences were aligned using Geneious Pro software. Bayesian posterior probabilities of branching demonstrate the robustness of the individual groups. (B) Distance matrix analysis of CDV H gene sequences. Pairwise identities of nucleotide and amino acid sequences (boldface) between different strains of CDV were obtained through GenBank and generated from a pairwise distance matrix calculated using PAUP software. Tracie A. Seimon et al. mBio 2013; doi:10.1128/mBio.00410-13