Inter-laboratory cohort Prognostication cohort

Slides:

Advertisements

Similar presentations

Interactions Between Vitamin D and Androgen Receptor Signaling in Prostate Cancer Cells Nancy L. Weigel, Ph.D. Baylor College of Medicine.

Advertisements

ADT, Estramustine, Dexamethasone Prednisolone Radiotherapy (Months) (ng/mL) PSA Time Patient A Patient B Patient.

Blood and Tissue Based Molecular Signatures in Predicting Prostate Cancer Progression Tarek A. Bismar, MD Professor, University of Calgary Departments.

Supplementary Figure 2: Representative Kaplan-Meier plots of overall survival considering alterations erbB signaling pathway genes and p53 in lung cancer.

AR-V7 Splice Variant in Prostate Cancer : Taking Centre Stage

Supplementary Figure 1: Correlation analysis of DKC1 mRNA and dyskerin protein quantity in neuroblastoma cell lines.

Intermediate Atypical Carcinoma: Novel Histologic Subtype of mCRPC in Patients Resistant to Androgen Receptor Agonists CCO Independent Conference Highlights.

Figure S1. A B C Survival probability (%) P = 0.21 P = 0.37 P = 0.12

Frances A Shepherd, MD, Rafael Rosell, MD Journal of Thoracic Oncology

Rupp et al. Supplementary Figure 1: Structure of the human troponin T gene Exon 6 Genomic DNA cDNA from mRNA mutation Exon 9 Exon bp Parts of genomic.

TUMOR PD-L1 TIL PD-L1 TUMOR & TIL PD-L1 Age Low High P value R Pearson

Volume 18, Issue 8, Pages (August 2016)

Fig. 1. EGFR content as determined by fluorescence in situ hybridization (FISH) and immunohistochemical staining. FISH was performed with the EGFR ( red.

TBCRC (the translational breast cancer research consortium) 005 Prospective study

Loss of Hdac3 impairs Ar signaling in mouse prostate tissues and has no effect on apoptosis Loss of Hdac3 impairs Ar signaling in mouse prostate tissues.

Summary of genetic alterations in resistant biopsies among patients progressing on ceritinib or alectinib. Summary of genetic alterations in resistant.

C-myb Transactivates the Human Cyclin A1 Promoter and Induces Cyclin A1 Gene Expression by Carsten Müller, Rong Yang, Gregory Idos, Nicola Tidow, Sven.

Lu Chen, PhD, Brienne E. Engel, PhD, Eric A. Welsh, PhD, Sean J

Monitoring EGFR mutation status in Non-small cell lung cancer (NSCLC) patients using circulating Tumour DNA (ctDNA). Matthew Smith Molecular Pathology.

Regional lymph nodes and distal extracranial metastases are not a reliable surrogate for actionable mutation in brain metastases. Regional lymph nodes.

Increased MAPK1/3 Phosphorylation in Luminal Breast Cancer Related with PIK3CA Hotspot Mutations and Prognosis Diana Ramirez-Ardila, A. Mieke Timmermans,

The mRNA stem cell signature.

Volume 70, Issue 4, Pages (October 2016)

SPRY2 deficiency mediates androgen autonomous CRPC

Epidermal Growth Factor Facilitates Melanoma Lymph Node Metastasis by Influencing Tumor Lymphangiogenesis Andreas Bracher, Ana Soler Cardona, Stefanie.

Intrinsic and acquired trastuzumab resistance.

Cross sectional comparisons of GAPDH and β-actin gene expression.

AR signaling in CTCs from CRPC patients treated with abiraterone acetate. AR signaling in CTCs from CRPC patients treated with abiraterone acetate. A,

Nat. Rev. Neurol. doi: /nrneurol

Volume 19, Issue 11, Pages (November 2017)

Analytical Validation of Androgen Receptor Splice Variant 7 Detection in a Clinical Laboratory Improvement Amendments (CLIA) Laboratory Setting Parvez.

Volume 18, Issue 8, Pages (August 2016)

Disease-specific survival

SPRY2 deficiency mediates CRPC

CHK1 downregulation upon ERG overexpression.

Volume 127, Issue 2, Pages (August 2004)

SPRY2 deficiency‐induced IL6 drives CRPC by elevating tumoral HSD3B1 and cholesterol levels SPRY2 deficiency‐induced IL6 drives CRPC by elevating tumoral.

PROSTATE CANCER CIRCULATING BIOMARKER CONSENSUS STATEMENT QUESTIONS

Bernard et al, Supplementary Figure S1

Alterations related to androgen signaling.

Clinical Significance of Epidermal Growth Factor Receptors in Non-small Cell Lung Cancer and a Prognostic Role for HER2 Gene Copy Number in Female Patients

FMRP is highly expressed in human breast cancer and distal metastasis FMRP expression on human TMAs containing normal and multi‐tumour tissues. FMRP is.

A B Supplementary Figure S1 PC3 cells Vehicle 3β-Adiol

SPRY2 deficiency‐induced IL6 drives CRPC by elevating tumoral HSD3B1 and cholesterol levels SPRY2 deficiency‐induced IL6 drives CRPC by elevating tumoral.

(A) Schematic representation of the conditional Lats2 locus.

SPRY2 deficiency mediates CRPC

Supplementary Figure S1

Clinical Utility of Circulating Tumour Cell Androgen Receptor Splice Variant-7 Status in Metastatic Castration-resistant Prostate Cancer Adam Sharp,

Fig. 1 AVPR1A is regulated by the AR coactivator VAV3 and AR-V7 and is increased in advanced human PC. AVPR1A is regulated by the AR coactivator VAV3 and.

Survival based on V gene mutation status and CD38 expression among B-CLL patients who stratify to the Rai intermediate risk category. Survival based on.

Figure 4 Algorithm for when to determine PTEN

Fig. 1. Detection of circulating tumor DNA in CRPC patients.

On the left, Euler-Venn diagram of point mutations detected by lbNGS and ttNGS on matched genes from the same patients; on the right, the percentage of.

TERT promoter mutations and telomerase reactivation in urothelial cancer by Sumit Borah, Linghe Xi, Arthur J. Zaug, Natasha M. Powell, Garrett M. Dancik,

Representative examples of estrogen receptor α and β immunohistochemical expression (top figures) and EGFR mutations (bottom figures) in lung adenocarcinomas.

IL6 mRNA is not detected in metastatic prostate cancer cells.

AXL is not expressed in human prostate tumors.

EGFR and cetuximab sensitivity of SCCUAT

Active AR signaling in enzalutamide-resistant xenograft tumors.

EN1 expression in breast cancer and clinical outcome.

Detection of PSA-mRNA by single (first panel, 710 bp) and nested (second panel, 455 bp) RT-PCR. Detection of PSA-mRNA by single (first panel, 710 bp) and.

IL1R8 is downmodulated in human lymphoma cell lines.

Survival risk prediction analysis and application of the metastasis gene signature. Survival risk prediction analysis and application of the metastasis.

Nested RT-PCR of Mammaglobin and CK19 mRNA in plasma and circulating cells of controls (C) and patients (T) with breast cancer. Nested RT-PCR of Mammaglobin.

BAF57 is highly expressed in human prostate cancer specimens.

Detection of E-cadherin fragments in human prostate cancer metastases.

Effects of W. chinensis extract on androgen activity and growth of prostate cancer cells. Effects of W. chinensis extract on androgen activity and growth.

A, study design for measuring the feasibility, concordance, and accuracy of a plasma-based cfDNA sequencing test compared with biopsy-based sequencing.

NRP2 expression is associated with prostate cancer progression.

Coincidence and prognostic significance of PD-1+ and CD103+ cells in HGSC. Serial sections from the 490-case TMA were stained with antibodies to CD103.

Presentation transcript:

Inter-laboratory cohort Prognostication cohort Sharp et al; Supplementary Figure S1 Whole PB cohort 277 samples (181 patients) AdnaTestTM Section 3.1-3.2; Figure 1 Inter-laboratory cohort CTC cohort IHC cohort Prognostication cohort Excluded: 221 samples No sequential PB sample Excluded: 75 samples No CellSearchTM sample within one month Excluded: 212 samples No tissue biopsy within one month Excluded: 115 samples Duplicate sample No survival data 56 samples (49 patients) Sequential samples Section 3.3; Figure S4 202 samples (136 patients) AdnaTestTM and CellSearchTM within one month Section 3.4; Figure 2 65 samples (58 patients) AdnaTestTM and tissue IHC/NGS within one month Section 3.5; Figure 3 162 samples (162 patients) Unique PB with longest follow up Section 3.6; Figure 4 - AdnaTestTM CTC call and AR-V7/AR-FL quantification - AdnaTestTM CTC call and AR-V7/AR-FL quantification - CellSearchTM CTC count - AdnaTestTM CTC call and AR-V7/AR-FL quantification IHC for AR-FL/AR-V7 protein NGS for AR copy number and mutational status - AdnaTestTM CTC call and AR-V7/AR-FL quantification - Overall survival from PB draw

Sharp et al; Supplementary Figure S2

Sharp et al; Supplementary Figure S3 Spiked HV blood (500 cells) A B LNCaP95 spiked HV blood LNCaP95 No spike Negative control Positive control Positive Ladder LNCaP 15 cells 250 cells PC3 PSMA PSMA PSA PSA EGFR EGFR Actin Actin C gBlock gene fragments AR-FL amplicon Exon 7-8 AR-V7 amplicon Exon 3-3c gBlock FASTA sequence CAGCCTATTGCGAGAGAGCTGCATCAGTTCACTTTTGACCTGCTAATCAAGTCACACATGGTGAGCGTGGACTTTCCGGAAATGATGGCAGAGATCATCTCTGTGCAAGTGCCCAAGATCCTTTCCCATCTTGTCGTCTTCGGAAATGTTATGAAGCAGGGATGACTCTGGGAGGAAAAATTCCGGGTTGGCAATTGCAAGCATCTCAAAATGACCAGACCCTGAAGAAAGGCTGACTTGCCTCATTCAAA D AR-FL standard curve AR-V7 standard curve Ct value Ct value mRNA expression (copies/ml) mRNA expression (copies/ml)

Sharp et al; Supplementary Figure S4

Co-occurrence of markers in samples with CTCs detected (136 samples) Sharp et al; Supplementary Figure S5 Co-occurrence of markers in samples with CTCs detected (136 samples) 136 22 128 70 Actin 19 8 EGFR 67 PSA PSMA

CRPC lymph node metastasis (two patients) Sharp et al; Supplementary Figure S6 AR-FL AR-V7 CRPC lymph node metastasis (two patients)

Sharp et al; Supplementary Figure S7 22Rv1* VCaP^ Prostate PC3* AR-FL B 22Rv1* VCaP^ DU145^ PC3* AR-V7