Inter-laboratory cohort Prognostication cohort Sharp et al; Supplementary Figure S1 Whole PB cohort 277 samples (181 patients) AdnaTestTM Section 3.1-3.2; Figure 1 Inter-laboratory cohort CTC cohort IHC cohort Prognostication cohort Excluded: 221 samples No sequential PB sample Excluded: 75 samples No CellSearchTM sample within one month Excluded: 212 samples No tissue biopsy within one month Excluded: 115 samples Duplicate sample No survival data 56 samples (49 patients) Sequential samples Section 3.3; Figure S4 202 samples (136 patients) AdnaTestTM and CellSearchTM within one month Section 3.4; Figure 2 65 samples (58 patients) AdnaTestTM and tissue IHC/NGS within one month Section 3.5; Figure 3 162 samples (162 patients) Unique PB with longest follow up Section 3.6; Figure 4 - AdnaTestTM CTC call and AR-V7/AR-FL quantification - AdnaTestTM CTC call and AR-V7/AR-FL quantification - CellSearchTM CTC count - AdnaTestTM CTC call and AR-V7/AR-FL quantification IHC for AR-FL/AR-V7 protein NGS for AR copy number and mutational status - AdnaTestTM CTC call and AR-V7/AR-FL quantification - Overall survival from PB draw
Sharp et al; Supplementary Figure S2
Sharp et al; Supplementary Figure S3 Spiked HV blood (500 cells) A B LNCaP95 spiked HV blood LNCaP95 No spike Negative control Positive control Positive Ladder LNCaP 15 cells 250 cells PC3 PSMA PSMA PSA PSA EGFR EGFR Actin Actin C gBlock gene fragments AR-FL amplicon Exon 7-8 AR-V7 amplicon Exon 3-3c gBlock FASTA sequence CAGCCTATTGCGAGAGAGCTGCATCAGTTCACTTTTGACCTGCTAATCAAGTCACACATGGTGAGCGTGGACTTTCCGGAAATGATGGCAGAGATCATCTCTGTGCAAGTGCCCAAGATCCTTTCCCATCTTGTCGTCTTCGGAAATGTTATGAAGCAGGGATGACTCTGGGAGGAAAAATTCCGGGTTGGCAATTGCAAGCATCTCAAAATGACCAGACCCTGAAGAAAGGCTGACTTGCCTCATTCAAA D AR-FL standard curve AR-V7 standard curve Ct value Ct value mRNA expression (copies/ml) mRNA expression (copies/ml)
Sharp et al; Supplementary Figure S4
Co-occurrence of markers in samples with CTCs detected (136 samples) Sharp et al; Supplementary Figure S5 Co-occurrence of markers in samples with CTCs detected (136 samples) 136 22 128 70 Actin 19 8 EGFR 67 PSA PSMA
CRPC lymph node metastasis (two patients) Sharp et al; Supplementary Figure S6 AR-FL AR-V7 CRPC lymph node metastasis (two patients)
Sharp et al; Supplementary Figure S7 22Rv1* VCaP^ Prostate PC3* AR-FL B 22Rv1* VCaP^ DU145^ PC3* AR-V7