Beginning of the chapter Epigenetics and genetics

Slides:

Advertisements

Similar presentations

Heredity Vs. Environment

Advertisements

Obesity Matt Jarvis. Obesity Why is obesity a concern? Obesity is an excess of body fat that is associated with risks to health. It is associated with.

Introduction to Human Genetics. Facts Humans have 46 chromosomes or 23 pairs of chromosomes 2 types of chromosomes: –Autosomes: chromosomes that determine.

How Genes are Controlled Chapter 11. Human Cells…. All share the same genome What makes them different????

How to remember the health concerns Breast cancer Big Osteoporosis Olga Heart disease Hates Hypertension Housework/herpes Anaemia And Dental Caries Doesn’t.

Diet Related Diseases and Disorders Introduce and Begin Project.

Human genetics. Sex-influenced traits are autosomal traits that are influenced by sex. If a male has one recessive allele, he will show that trait, but.

Diseases that are not spread by pathogens, but instead by heredity, birth, lifestyle or the environment. These diseases are often called chronic and degenerative:

Heredity and Genetics Overview DNA. What is Heredity? Heredity is the passing on of traits or characteristics from one generation to the next. Heredity.

Why study genetics? It has a profound effect on your life!

Misconceptions Relating to structures of the body and nutrition.

Date EntryPage # 1/8 Genetic Terms5 1/13 Traits Lab6 1/13 Where is DNA?7 1/13 Tour of Basics8.

Genetics Review Honors Human Anatomy & Physiology Mr. Mazza

Health Mrs. Wagner.  Genetic – Hereditary – carried on Recessive Gene – must have 2 recessive genes to get birth defect  Chromosomal – 23 pairs from.

Regulating The Cell Cycle. Warm Up – The Cell Cycle The cell spends 80% of the time in _______________ and 20% of the time in ________________ What are.

Genetic Disorders – Gene Disorders. What is a gene? Gene – Sequence of DNA bases that code for a trait (blueprint)

Other Diseases & Disabilities

DNA Methylation + Epigenetics

Chapter 2 Your Heredity.  Chromosomes  Where heredity information is stored  Gene  The basic unit of heredity  Dominant gene  The more influential.

{ NUTRIENTS IN MILK Demonstration next class. Nutrient: MINERAL Nutrient in MilkImportance to Body 1. CalciumBuilds strong bones and teeth; strengthens.

Heredity Disease Lesson 2 Ch 18. What are genes? Genes control the activities of cells and determine a person’s physical characteristics. Genes are passed.

Diseases caused by abnormal chromosomes or by defective genes inherited from one or both parents.

Gene Expression Chapter 11. Gene Expression…Why? Your cells use the message contained in your genome (DNA) to produce several thousand different proteins.

Lesson Overview Lesson Overview Gene Regulation and Expression Do Now (notes 1.Write this original sequence of DNA bases (this is the template) 2.Use DNA.

Beginning of the chapter What are genes and what information do we get from genetic analyses? 13.

Audio-Visual-Oral English for Medical Purpose

Genetics Lesson 4 Mutations.

Notes: Nature Vs. nurture

Galactosemia(GALT) By Raveeja V Deshpande.

Nutrition 6th Grade Wellness.

Genes Genes play an important role in our physical appearance.

Body Parts, Organs & Their Functions

Section 18.4 Heredity Objectives

Look at photos on the following slides of famous family members.

Chapter 10/11 Cell Division.

Section 18.4 Heredity Objectives

Chapter 15 Controls over Genes.

April 12 Chromosomes and DNA

Types of variation.

How different types of cells look different!!

سرطان الثدي Breast Cancer

Vocabulary- Human body #3

HW: The Great Stem Cell Debate reading and questions

BTEC Level 2 Applied Science Unit 7: Health Applications of Life Science Diseases.

Can you think of any characteristics or traits you may have that could be affected by the environment?

Warm Up – Visual Analysis

Bellwork: How is gene regulation in prokaryotes and Eukaryotes similar

Apples with peanuts heart health.

How does the ENVIRONMENT affect the traits of organisms?

Changes in DNA that affect genetic information

Could you put an image here?

Regulation of Gene Expression

What makes an apple so healthy?

Inherited Traits vs. Acquired Traits

Genetics Notes.

1.1 Themes in Biology pp Write a COMPLETE SENTENCE for a 6 year old, that explains what DNA does, or what it is. IN.

Unit 4 – Development through the Life Stages

Methyl Madness: The Road to the Final Phenotype

STAAR Notebook 2.

ANTH 331: Culture and the Individual EPIGENETICS

How does the environment affect inherited traits?

Gene Mutations.

Multifactorial genetic disorders, or complex traits, result from several genes in combination with lifestyle and environmental influences. Multifactorial.

Does the environment affect the traits of an organism?

Physical Education Vocabulary Set #7

Predicting Individual Differences

Presentation transcript:

Beginning of the chapter Epigenetics and genetics 18 Beginning of the chapter Epigenetics and genetics

GENETICS Epi-Genetics

Genetics - blueprint of the body EPIGENETICS What is epigenetics? Genetics - blueprint of the body Instruction: How is food digested? Instruction: How are blood sugar levels regulated? Instruction: What color should eyes have? Instruction: How are strong bones built? Gene defective >> missing function of the body >> disease Epigenetics - "volume control" for the genes Environmental factors turn genes on (make them LOUDER) Environmental factors turn genes off (they make QUIETER) „Louder“ und „Quieter“ genes influence processes in the body Epigenetic programming can be inherited

EPIGENETICS What is epigenetics? 1944 Netherlands 1947 Netherlands 1997 Netherlands 2013 Netherlands Famine 400kcal/Day Heart disease Breast cancer Obesity Heart disease Breast cancer Obesity Environmental impact on the mother in 1944 influences the health of the descendants two generations later

How does epigenetics work? Lactose digestion Lactose digestion GTCTTACTTAGCCCTTTAAAGATCGAATCCGCGGCAGAATACATCGAAGGATTCGCTATATTAGG Heterochromatin

How does epigenetics work? Famine 400kcal/Tag Function A Function B Function C Function D Function E Function F

How does epigenetics work?

How does epigenetics work? If epigenetics can turn on or off different genes, doesn‘t this overrule the genetic defects? Lactose digestion GTCTTACTTAGCCCTTTAAAGATCGAATCCGCGGCAGAATACATCGAAGGATTCGCTATATTAGG Answer: Some genetic defects destroy the instructions for the body. These instructions are completely lost, and cannot be recovered by epigenetics. >> Gene mutations cause severe diseases

Epigenetics and genetics 18 End of the chapter Epigenetics and genetics