DNA – How it Works Part 1

Chromosomes are made of DNA…

DNA has two sides, each made of nucleotides…

Base Pairs ALWAYS Match Up! Adenine with Thymine and vice versa Adenine with Thymine and vice versa Cytosine with Guanine and vice versa Cytosine with Guanine and vice versa A & G are Purines – double rings A & G are Purines – double rings C & T are Pyrimidines – single rings C & T are Pyrimidines – single rings

A look at the base pairs…

DNA Replication – Making a copy…

How it works… Helicase (an enzyme) unzips the DNA Helicase (an enzyme) unzips the DNA Each strand is used as a template to build a complementary strand Each strand is used as a template to build a complementary strand When the complementary strand is complete, it twists with the template strand to form a new double helix!! When the complementary strand is complete, it twists with the template strand to form a new double helix!! (Look at your coloring!!) (Look at your coloring!!)

Also, keep in mind… The Point where the double helix separates is called the replication fork (looks like a Y) The Point where the double helix separates is called the replication fork (looks like a Y) Enzymes called DNA polymerase move along each strand adding the corresponding nucleotides! Enzymes called DNA polymerase move along each strand adding the corresponding nucleotides!

New DNA – Exactly like the old!

You tell me the complimentary strand… ATGGCGTCATGCTTAGATTACA ATGGCGTCATGCTTAGATTACA TACCGCAGTACGAATCTAATGT TACCGCAGTACGAATCTAATGT