The Gateway® Cloning System Cloning multiple fragments into a single vector Contents How to clone up to 4 DNA fragments simultaneously into one destination vector. Examples of expression of multiple genes in HeLa cells. Example of testing the effects of promoters and regulatory elements on protein expression. In the previous sections, we discussed the mechanism of transfer of a single DNA fragment among vectors via BP and LR recombination reactions. However, the full power of this system is realized when multiple DNA fragments are simultaneously assembled into a single vector in a predefined order, orientation, and reading frame.

MultiSite Gateway® - Extending the applications Your Application Gene1 Gene2 Gene3 Gene4 Gene Protein Localization Purification RNAi Cell-Free interaction Entry Clone PCR synthesis ORF collection Library Your Source MultiSite Gateway® and MultiSite Gateway® Pro represent an extension of the Gateway site-specific recombinational cloning system. The introduction of new att site specificities allows simultaneous cloning of multiple DNA fragments in a defined order and orientation Invitrogen Proprietary & Confidential

Sample Applications Optimized multigene delivery without co-transfection Expression of enzymatic pathways Expression of multi-subunit protein complexes Gene knock-down and rescue (controllable RNAi and heterologous gene expression from the same construct) Variable gene expression levels using different expression elements Combinatorial tagging The approach has multiple applications to the engineering of proteins, pathways, and cells, and provides a highly flexible platform for functional analysis. Invitrogen Proprietary & Confidential

More att sequences needed   CTGCTTTTTTGTACAAACTTG attB1 CAGCTTTCTTGTACAAAGTTG attB2 CAACTTTATTATACAAAGTTG attB3 CAACTTTTCTATACAAAGTTG attB4 CAACTTTTGTATACAAAGTTG attB5 Standard Gateway® MultiSite Gateway® The recombination mechanism for creating a MultiSite Gateway® construct is the same as that with a single fragment. The difference is the att site specificity, which is determined at the single base level, as shown by the underlined nucleotides. Virtually no cross recombination is observed among them. Invitrogen Proprietary & Confidential

2-fragment MultiSite Gateway® Pro PCR Fragments attB1 attB5r attB5 attB2 X X X X pDONRs attP1 attP5r attP5 attP2 BP reactions attL5 attL2 Entry Clones X attL1 attR5 X In MultiSite Gateway® and MultiSite Gateway® Pro, entry clones are also constructed via BP recombination but in order for them to have the correct configuration in the final LR assembly reaction, a combination of flanking attL and attR sites is used. This is facilitated by the modular nature of the att sites. A different set of pDONR vectors is required. In this example a 2-fragment recombination using MultiSite Gateway® Pro is shown. Here, by reversing the “standard”’ orientation of the attB5 site to an attB5r site in the PCR fragment, and by doing the same with its cognate attP5 counterpart in the donor vector, an attR5, instead of an attL5 is generated in one of the entry clones. The second entry clone bears a standard attL5 sequence that allows pairing with attR5 and the generation of an attB5 via LR recombination. This concept is key to the function of the MultiSite Gateway® system. To perform the LR reaction the entry vectors are mixed with an appropriate destination vector and LR Clonase™ II Plus. The reaction is incubated for 16 hours at room temperature and an aliquot is used to transform E. coli competent cells. Recombinants are selected using the destination vector’s antibiotic resistance. Destination Vectors attR1 attR2 LR reaction Expression clones attB1 attB5 attB2 Invitrogen Proprietary & Confidential

3-fragment MultiSite Gateway® Pro PCR Fragments attB1 attB4 attB4r attB3r attB3 attB2 X X X X X X pDONRs attP1 attP4 attP4r attP3r attP3 attP2 BP reactions attL1 attL4 attL3 attL2 Entry clones X X attR4 attR3 The same rationale is applied to a 3-fragment recombination scheme using MultiSite Gateway® Pro. However, a different arrangement of the att sequences and a different set of pDONR vectors is required as shown in this slide. Destination vector attR1 CmR ccdB attR2 LR reaction Expression clone attB1 attB4 attB3 attB2 Invitrogen Proprietary & Confidential

4-fragment MultiSite Gateway® Pro PCR Fragments attB1 attB5r attB5 attB4 attB4r attB3r attB3 attB2 X X X X X X X X pDONRs attP1 attP5r attP5 attP4 attP4r attP3r attP3 attP2 BP reactions attL5 attL4 attL3 attL2 Entry Clones X X X attL1 attR5 attR4 attR3 X Destination Vectors And the same applies to a 4-fragment recombination scheme using MultiSite Gateway® Pro. attR1 attR2 LR reaction Expression clones attB1 attB5 attB4 attB3 attB2 Invitrogen Proprietary & Confidential

MultiSite Gateway® Three-Fragment Vector Construction Kit X attB1r attB4 attP1r attP4 attB2 attB1 attP2 attP1 attB3 attB2r attP3 attP2r PCR Fragments pDONRs BP reactions attL4 attR1 attR2 attL3 Entry clones X X attL1 attL2 Another MultiSite Gateway® strategy, called MultiSite Gateway® Three-Fragment Vector Construction kit enables the addition of 5’ and 3’ elements at both ends of standard attL1-attL2 entry clones (such as the Ultimate™ ORF clones). Note that in this case attR4-attR3 destination vectors are used. Destination vector attR4 CmR ccdB attR3 LR reaction attB3 attB4 attB2 attB1 Expression clone Invitrogen Proprietary & Confidential

Typical Results Number of Expected # colonies per Typical recombination recombining 10 L reaction ef ficiency (%) fragments 1 10 3 - 10 6 90 - 100 2 10 3 - 5 80 100 3 10 3 - 10 4 70 - 90 Sufficient numbers of colonies with the expected expression construct are obtained using any of the described configurations. 4 10 2 - 10 3 30 - 80 Invitrogen Proprietary & Confidential

In silico cloning using Vector NTI AdvanceTM 10.3 DNA of interest Primers for PCR reaction Cloning Strategy Vector NTI Advance™ software allows the generation of Entry and Expression clones starting from any DNA sequence template and using any of the available configurations. It automatically designs the primers for the generation of the PCR fragments used in the corresponding BP reactions. The program is downloadable from the Vector NTI User Community at www.invitrogen/VectorNTICommunity. Licenses are free for academic and government researchers. Free 30-day trial licenses are available for commercial researchers by emailing bioinfotrial@invitrogen.com. Invitrogen Proprietary & Confidential

Shortcomings when co-transfecting two plasmids EGFP mRFP EGFP mRFP EGFP PCAG Plasmid 1 This slide shows one of the shortcomings when co-transfecting two genes encoded by different plasmids. Some cells express one of the genes (EGFP) while others express only the other one (mRFP). In this particular example only one cell received and expressed both genes (marked with an arrow). MultiSite Gateway® overcomes this difficulty by recombining both genes into the same vector (see next slide) mRFP Plasmid 2 Courtesy of Dr. Imamoto, Osaka University, Japan Invitrogen Proprietary & Confidential

Example: Expression of Multiple Genes in Human Cells CFP YFP A pCMV B1 YFP B4 pEF1 a B3 CFP B2 B B1 pCMV B5 YFP B4 pEF1 a B3 CFP B2 As mentioned in the previous slide, multiple genes can be combined into a single plasmid. Thus, only one transfection experiment needs to be performed. In this set of experiments, YFP and CFP are combined with the CMV and EF1alpha promoters. In one case, the CMV promoter is part of the destination vector (A), whereas in the other case the promoter is introduced using an entry clone (B). Transfection of only one plasmid was used in each of these examples, and virtually all cells exhibit expression of both genes. Invitrogen Proprietary & Confidential

Rapid Testing of Expression Elements using MultiSite Gateway® Kozak or Promoter IRES EGFP pABGH HeLa Kozak or Gtx Determination of expression level of EGFP aurora A 2xGtx cdc 2 5xGtx cyclin B1 12xGtx cyclin E EMCV mHCV2a IRES ( Internal Ribosome Entry Site ) CMV mHCV33 By swapping promoters and/or regulatory elements using MultiSite Gateway®, you can fine-tune gene expression. In this experiment, several promoters were tested for their effect on protein expression. Then, different Kozak or IRES elements were tested together with the CMV promoter. The plasmid constructs were transfected into HeLa cells, and the expression levels of eGFP were determined. EF1-a mHCV45 ( CAG ) HCV2a ( SV40 ) HCV33 HCV45 Courtesy of Dr. Imamoto, Osaka University, Japan Invitrogen Proprietary & Confidential

Rapid Testing of Expression Elements using MultiSite Gateway® Kozak or Promoter IRES EGFP pA HeLa Transcriptional signals with Kozak Translational signals with CMV promoter 350 7 13 1 29 9 4 0.0 5.0 10.0 15.0 20.0 25.0 30.0 35.0 40.0 None Kozak Gtx 2xGtx 5xGtx 12xGtx EMCV mHCV2a mHCV33 mHCV45 300 250 Relative activity 200 150 100 These are the results from the experiment detailed in the previous slide. By swapping the promoter, dramatic changes in the protein expression levels were obtained. Fine tuning of the expression level is modulated by the use of different translation enhancers. 50 cdc 2 CMV aurora A cyclin B1 cyclin E EF1-a Courtesy of Dr. Imamoto, Osaka University, Japan Invitrogen Proprietary & Confidential

Summary for MultiSite Gateway® Technology MultiSite Gateway® Three-Fragment Vector Construction Kit MultiSite Gateway® Pro Compatible with… Ultimate™ ORF clones attL1-attL2 entry clones attR4-attR3 DEST vectors MultiSite Gateway® Pro entry clones attR1-attR2 DEST vectors Available for… Only 3-fragment cloning 2-, 3-, or 4-fragment cloning Applications Vector construction Promoter analysis Expression of multiple genes in one plasmid Reporter analysis …and more In summary, Invitrogen offers two different configurations for the MultiSite Gateway® Technology. The MultiSite Gateway® three fragment construction kit is available for three-fragment cloning and is compatible with destination vectors that have attR4-R3 sequences. MultiSite Gateway® Pro is highly flexible in that you can use any standard Gateway® destination vector (attR1-attR2) for 2-, 3-, or 4-fragment cloning. With a wide range of Invitrogen’s destination vectors and those developed by your lab or collaborators, you are able to tap into a variety of applications. Some examples have been highlighted in this seminar, but the possibilities are endless. Invitrogen Proprietary & Confidential