Www.bioalgorithms.infoAn Introduction to Bioinformatics Algorithms Protein Sequencing and Identification by Mass Spectrometry.

Slides:



Advertisements
Similar presentations
Gene Prediction: Similarity-Based Approaches
Advertisements

Genomes and Proteomes genome: complete set of genetic information in organism gene sequence contains recipe for making proteins (genotype) proteome: complete.
Kaizhong Zhang Department of Computer Science University of Western Ontario London, Ontario, Canada Joint work with Bin Ma, Gilles Lajoie, Amanda Doherty-Kirby,
The Use of Graph Matching Algorithms to Identify Biochemical Substructures in Synthetic Chemical Compounds Application to Metabolomics Mai Hamdalla, David.
Sequence comparison: Significance of similarity scores Genome 559: Introduction to Statistical and Computational Genomics Prof. James H. Thomas.
Protein Sequencing and Identification by Mass Spectrometry.
Protein – Protein Interactions Lisa Chargualaf Simon Kanaan Keefe Roedersheimer Others: Dr. Izaguirre, Dr. Chen, Dr. Wuchty, ChengBang Huang.
Fa07CSE 182 CSE182-L4: Database filtering. Fa07CSE 182 Summary (through lecture 3) A2 is online We considered the basics of sequence alignment –Opt score.
Blast to Psi-Blast Blast makes use of Scoring Matrix derived from large number of proteins. What if you want to find homologs based upon a specific gene.
Whole genome alignments Genome 559: Introduction to Statistical and Computational Genomics Prof. James H. Thomas.
Protein Sequencing and Identification by Mass Spectrometry
How to identify peptides October 2013 Gustavo de Souza IMM, OUS.
CSE182 CSE182-L12 Mass Spectrometry Peptide identification.
Protein Sequencing and Identification by Mass Spectrometry.
Fa 05CSE182 CSE182-L7 Protein sequencing and Mass Spectrometry.
Heuristic alignment algorithms and cost matrices
Peptide Identification by Tandem Mass Spectrometry Behshad Behzadi April 2005.
Whole Genome Alignment using Multithreaded Parallel Implementation Hyma S Murthy CMSC 838 Presentation.
Data Processing Algorithms for Analysis of High Resolution MSMS Spectra of Peptides with Complex Patterns of Posttranslational Modifications Shenheng Guan.
PEAKS: De Novo Sequencing using MS/MS spectra Bin Ma, U. Western Ontario, Canada Kaizhong Zhang,U. Western Ontario, Canada Chengzhi Liang, Bioinformatics.
Mass Spectrometry Peptide identification
Fa 05CSE182 CSE182-L8 Mass Spectrometry. Fa 05CSE182 Bio. quiz What is a gene? What is a transcript? What is translation? What are microarrays? What is.
Introduction to Bioinformatics Algorithms Sequence Alignment.
Bioinformatics Unit 1: Data Bases and Alignments Lecture 3: “Homology” Searches and Sequence Alignments (cont.) The Mechanics of Alignments.
Mass spectrometry in proteomics Modified from: I519 Introduction to Bioinformatics, Fall, 2012.
Proteomics Informatics – Protein identification II: search engines and protein sequence databases (Week 5)
Previous Lecture: Regression and Correlation
Mass Spectrometry. What are mass spectrometers? They are analytical tools used to measure the molecular weight of a sample. Accuracy – 0.01 % of the total.
Scaffold Download free viewer:
My contact details and information about submitting samples for MS
A combination of the words Proteomics and Genomics. Proteogenomics commonly refer to studies that use proteomic information, often derived from mass spectrometry,
1 Mass Spectrometry-based Proteomics Xuehua Shen (Adapted from slides with textbook)
1 Mass Spectrometry-based Proteomics Xuehua Shen (Adapted from slides with textbook)
Sequencing a genome and Basic Sequence Alignment
Whole genome alignments Genome 559: Introduction to Statistical and Computational Genomics Prof. James H. Thomas
Fa 05CSE182 CSE182-L9 Mass Spectrometry Quantitation and other applications.
Protein sequencing and Mass Spectrometry. Sample Preparation Enzymatic Digestion (Trypsin) + Fractionation.
TM Biological Sequence Comparison / Database Homology Searching Aoife McLysaght Summer Intern, Compaq Computer Corporation Ballybrit Business Park, Galway,
Tryptic digestion Proteomics Workflow for Gel-based and LC-coupled Mass Spectrometry Protein or peptide pre-fractionation is a prerequisite for the reduction.
Sequence Alignment.
BIONFORMATIC ALGORITHMS Ryan Tinsley Brandon Lile May 9th, 2014.
Space-Efficient Sequence Alignment Space-Efficient Sequence Alignment Bioinformatics 202 University of California, San Diego Lecture Notes No. 7 Dr. Pavel.
The dynamic nature of the proteome
PROTEIN STRUCTURE NAME: ANUSHA. INTRODUCTION Frederick Sanger was awarded his first Nobel Prize for determining the amino acid sequence of insulin, the.
Protein Sequence Alignment and Database Searching.
INF380 - Proteomics-91 INF380 – Proteomics Chapter 9 – Identification and characterization by MS/MS The MS/MS identification problem can be formulated.
Pairwise Sequence Alignment. The most important class of bioinformatics tools – pairwise alignment of DNA and protein seqs. alignment 1alignment 2 Seq.
Common parameters At the beginning one need to set up the parameters.
Sequence Analysis CSC 487/687 Introduction to computing for Bioinformatics.
Hugh E. Williams and Justin Zobel IEEE Transactions on knowledge and data engineering Vol. 14, No. 1, January/February 2002 Presented by Jitimon Keinduangjun.
Analysis of Complex Proteomic Datasets Using Scaffold Free Scaffold Viewer can be downloaded at:
A Comprehensive Comparison of the de novo Sequencing Accuracies of PEAKS, BioAnalyst and PLGS Bin Ma 1 ; Amanda Doherty-Kirby 1 ; Aaron Booy 2 ; Bob Olafson.
Sequencing a genome and Basic Sequence Alignment
Laxman Yetukuri T : Modeling of Proteomics Data
INF380 - Proteomics-101 INF380 – Proteomics Chapter 10 – Spectral Comparison Spectral comparison means that an experimental spectrum is compared to theoretical.
Chapter 3 Computational Molecular Biology Michael Smith
Introduction to Bioinformatics Algorithms Protein Sequencing and Identification by Mass Spectrometry.
BLAST: Basic Local Alignment Search Tool Altschul et al. J. Mol Bio CS 466 Saurabh Sinha.
Sequence Comparison Algorithms Ellen Walker Bioinformatics Hiram College.
Protein Identification via Database searching Attila Kertész-Farkas Protein Structure and Bioinformatics Group, ICGEB, Trieste.
PEAKS: De Novo Sequencing using Tandem Mass Spectrometry Bin Ma Dept. of Computer Science University of Western Ontario.
CSE182 CSE182-L12 Mass Spectrometry Peptide identification.
CSE182 CSE182-L11 Protein sequencing and Mass Spectrometry.
Introduction to Bioinformatics Algorithms Protein Sequencing and Identification by Mass Spectrometry.
Tag-based Blind Identification of PTMs with Point Process Model 1 Chunmei Liu, 2 Bo Yan, 1 Yinglei Song, 2 Ying Xu, 1 Liming Cai 1 Dept. of Computer Science.
De Novo Peptide Sequencing via Probabilistic Network Modeling PepNovo.
Constructing high resolution consensus spectra for a peptide library
김지형. Introduction precursor peptides are dynamically selected for fragmentation with exclusion to prevent repetitive acquisition of MS/MS spectra.
Protein Identification via Database searching
Presentation transcript:

Introduction to Bioinformatics Algorithms Protein Sequencing and Identification by Mass Spectrometry

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Outline Tandem Mass Spectrometry De Novo Peptide Sequencing Spectrum Graph Protein Identification via Database Search Identifying Post Translationally Modified Peptides Spectral Convolution Spectral Alignment

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Masses of Amino Acid Residues

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Protein Backbone H...-HN-CH-CO-NH-CH-CO-NH-CH-CO-…OH R i-1 RiRi R i+1 AA residue i-1 AA residue i AA residue i+1 N-terminus C-terminus

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Peptide Fragmentation Peptides tend to fragment along the backbone. Fragments can also loose neutral chemical groups like NH 3 and H 2 O. H...-HN-CH-CO... NH-CH-CO-NH-CH-CO-…OH R i-1 RiRi R i+1 H+H+ Prefix FragmentSuffix Fragment Collision Induced Dissociation

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Breaking Protein into Peptides and Peptides into Fragment Ions Proteases, e.g. trypsin, break protein into peptides. A Tandem Mass Spectrometer further breaks the peptides down into fragment ions and measures the mass of each piece. Mass Spectrometer accelerates the fragmented ions; heavier ions accelerate slower than lighter ones. Mass Spectrometer measure mass/charge ratio of an ion.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info N- and C-terminal Peptides N-terminal peptides C-terminal peptides

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Terminal peptides and ion types Peptide Mass (D) = 415 Peptide Mass (D) – 18 = 397 without

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info N- and C-terminal Peptides N-terminal peptides C-terminal peptides

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info N- and C-terminal Peptides N-terminal peptides C-terminal peptides

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info N- and C-terminal Peptides

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info N- and C-terminal Peptides Reconstruct peptide from the set of masses of fragment ions (mass-spectrum)

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Peptide Fragmentation y3y3 b2b2 y2y2 y1y1 b3b3 a2a2 a3a3 HO NH 3 + | | R 1 O R 2 O R 3 O R 4 | || | || | || | H -- N --- C --- C --- N --- C --- C --- N --- C --- C --- N --- C -- COOH | | | | | | | H H H H H H H b2-H2Ob2-H2O y 3 -H 2 O b 3 - NH 3 y 2 - NH 3

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Mass Spectra GVDLK mass 0 57 Da = ‘G’ 99 Da = ‘V’ L K DVG The peaks in the mass spectrum: Prefix Fragments with neutral losses (-H 2 O, -NH 3 ) Noise and missing peaks. and Suffix Fragments. D H2OH2O

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Protein Identification with MS/MS GVDLK mass 0 Intensity mass 0 MS/MS Peptide Identification:

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Tandem Mass-Spectrometry

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Breaking Proteins into Peptides peptides MPSER …… GTDIMR PAKID …… HPLC To MS/MS MPSERGTDIMRPAKID protein

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Mass Spectrometry Matrix-Assisted Laser Desorption/Ionization (MALDI) From lectures by Vineet Bafna (UCSD)

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Tandem Mass Spectrometry Scan 1708 LC Scan 1707 MS MS/MS Ion Source MS-1 collision cell MS-2

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Protein Identification by Tandem Mass Spectrometry Sequence MS/MS instrument Database search Sequest de Novo interpretation Sherenga

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Tandem Mass Spectrum Tandem Mass Spectrometry (MS/MS): mainly generates partial N- and C-terminal peptides Spectrum consists of different ion types because peptides can be broken in several places. Chemical noise often complicates the spectrum. Represented in 2-D: mass/charge axis vs. intensity axis

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info De Novo vs. Database Search W R A C V G E K D W L P T L T W R A C V G E K D W L P T L T De Novo AVGELTK Database Search Database of all peptides = 20 n AAAAAAAA,AAAAAAAC,AAAAAAAD,AAAAAAAE, AAAAAAAG,AAAAAAAF,AAAAAAAH,AAAAAAI, AVGELTI, AVGELTK, AVGELTL, AVGELTM, YYYYYYYS,YYYYYYYT,YYYYYYYV,YYYYYYYY Database of known peptides MDERHILNM, KLQWVCSDL, PTYWASDL, ENQIKRSACVM, TLACHGGEM, NGALPQWRT, HLLERTKMNVV, GGPASSDA, GGLITGMQSD, MQPLMNWE, ALKIIMNVRT, AVGELTK, HEWAILF, GHNLWAMNAC, GVFGSVLRA, EKLNKAATYIN.. Mass, Score

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info De Novo vs. Database Search: A Paradox The database of all peptides is huge ≈ O(20 n ). The database of all known peptides is much smaller ≈ O(10 8 ). However, de novo algorithms can be much faster, even though their search space is much larger! A database search scans all peptides in the database of all known peptides search space to find best one. De novo eliminates the need to scan database of all peptides by modeling the problem as a graph search.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info De novo Peptide Sequencing Sequence

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Theoretical Spectrum

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Theoretical Spectrum (cont’d)

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Theoretical Spectrum (cont’d)

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Building Spectrum Graph How to create vertices (from masses) How to create edges (from mass differences) How to score paths How to find best path

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info S E Q U E N C E b Mass/Charge (M/Z)

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info a Mass/Charge (M/Z) S E Q U E N C E

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info S E Q U E N C E Mass/Charge (M/Z) a is an ion type shift in b

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info y Mass/Charge (M/Z) E C N E U Q E S

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Mass/Charge (M/Z) Intensity

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Mass/Charge (M/Z) Intensity

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info noise Mass/Charge (M/Z)

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info MS/MS Spectrum Mass/Charge (M/z) Intensity

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Some Mass Differences between Peaks Correspond to Amino Acids s s s e e e e e e e e q q q u u u n n n e c c c

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Ion Types Some masses correspond to fragment ions, others are just random noise Knowing ion types Δ={δ 1, δ 2,…, δ k } lets us distinguish fragment ions from noise We can learn ion types δ i and their probabilities q i by analyzing a large test sample of annotated spectra.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Example of Ion Type Δ={δ 1, δ 2,…, δ k } Ion types {b, b-NH 3, b-H 2 O} correspond to Δ={0, 17, 18} *Note: In reality the δ value of ion type b is -1 but we will “hide” it for the sake of simplicity

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Match between Spectra and the Shared Peak Count The match between two spectra is the number of masses (peaks) they share (Shared Peak Count or SPC) In practice mass-spectrometrists use the weighted SPC that reflects intensities of the peaks Match between experimental and theoretical spectra is defined similarly

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Peptide Sequencing Problem Goal: Find a peptide with maximal match between an experimental and theoretical spectrum. Input: S: experimental spectrum Δ : set of possible ion types m: parent mass Output: P: peptide with mass m, whose theoretical spectrum matches the experimental S spectrum the best

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Vertices of Spectrum Graph Masses of potential N-terminal peptides Vertices are generated by reverse shifts corresponding to ion types Δ={δ 1, δ 2,…, δ k } Every N-terminal peptide can generate up to k ions m-δ 1, m-δ 2, …, m-δ k Every mass s in an MS/MS spectrum generates k vertices V(s) = {s+δ 1, s+δ 2, …, s+δ k } corresponding to potential N-terminal peptides Vertices of the spectrum graph: {initial vertex}  V(s 1 )  V(s 2 ) ...  V(s m )  {terminal vertex}

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Reverse Shifts Two peaks b-H 2 O and b are given by the Mass Spectrum With a +H 2 O shift, if two peaks coincide that is a possible vertex. Mass/Charge (M/Z) Intensity Red: Mass Spectrum Blue: shift (+H 2 O) b/b-H 2 O+H 2 O b-H 2 O b+H 2 O

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Reverse Shifts Shift in H 2 O+NH 3 Shift in H 2 O

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Edges of Spectrum Graph Two vertices with mass difference corresponding to an amino acid A: Connect with an edge labeled by A Gap edges for di- and tri-peptides

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Paths Path in the labeled graph spell out amino acid sequences There are many paths, how to find the correct one? We need scoring to evaluate paths

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Path Score p(P,S) = probability that peptide P produces spectrum S= {s 1,s 2,…s q } p(P, s) = the probability that peptide P generates a peak s Scoring = computing probabilities p(P,S) = π s є S p(P, s)

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info For a position t that represents ion type d j : q j, if peak is generated at t p(P,s t ) = 1-q j, otherwise Peak Score

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Peak Score (cont’d) For a position t that is not associated with an ion type: q R, if peak is generated at t p R (P,s t ) = 1-q R, otherwise q R = the probability of a noisy peak that does not correspond to any ion type

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Finding Optimal Paths in the Spectrum Graph For a given MS/MS spectrum S, find a peptide P’ maximizing p(P,S) over all possible peptides P: Peptides = paths in the spectrum graph P’ = the optimal path in the spectrum graph

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Ions and Probabilities Tandem mass spectrometry is characterized by a set of ion types {δ 1,δ 2,..,δ k } and their probabilities {q 1,...,q k } δ i -ions of a partial peptide are produced independently with probabilities q i

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Ions and Probabilities A peptide has all k peaks with probability and no peaks with probability A peptide also produces a ``random noise'' with uniform probability q R in any position.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Ratio Test Scoring for Partial Peptides Incorporates premiums for observed ions and penalties for missing ions. Example: for k=4, assume that for a partial peptide P’ we only see ions δ 1,δ 2,δ 4. The score is calculated as:

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Scoring Peptides T- set of all positions. T i ={t δ1,, t δ2,...,,t δk, }- set of positions that represent ions of partial peptides P i. A peak at position t δj is generated with probability q j. R=T- U T i - set of positions that are not associated with any partial peptides (noise).

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Probabilistic Model For a position t δj  T i the probability p(t, P,S) that peptide P produces a peak at position t. Similarly, for t  R, the probability that P produces a random noise peak at t is:

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Probabilistic Score For a peptide P with n amino acids, the score for the whole peptides is expressed by the following ratio test:

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info De Novo vs. Database Search W R A C V G E K D W L P T L T W R A C V G E K D W L P T L T De Novo AVGELTK Database Search Database of known peptides MDERHILNM, KLQWVCSDL, PTYWASDL, ENQIKRSACVM, TLACHGGEM, NGALPQWRT, HLLERTKMNVV, GGPASSDA, GGLITGMQSD, MQPLMNWE, ALKIIMNVRT, AVGELTK, HEWAILF, GHNLWAMNAC, GVFGSVLRA, EKLNKAATYIN..

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info De Novo vs. Database Search: A Paradox de novo algorithms are much faster, even though their search space is much larger! A database search scans all peptides in the search space to find best one. De novo eliminates the need to scan all peptides by modeling the problem as a graph search. Why not sequence de novo?

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Why Not Sequence De Novo? De novo sequencing is still not very accurate! Less than 30% of the peptides sequenced were completely correct! Algorithm Amino Acid Accuracy Whole Peptide Accuracy Lutefisk (Taylor and Johnson, 1997) SHERENGA (Dancik et. al., 1999) Peaks (Ma et al., 2003) PepNovo (Frank and Pevzner, 2005)

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Pros and Cons of de novo Sequencing Advantage: Gets the sequences that are not necessarily in the database. An additional similarity search step using these sequences may identify the related proteins in the database. Disadvantage: Requires higher quality data. Often contains errors.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Role of de novo Interpretation Interpreting MS/MS of novel peptides Automatic validation of MS/MS database matches. Leveraging homology matching across species

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Peptide Sequencing Problem Goal: Find a peptide with maximal match between an experimental and theoretical spectrum. Input: S: experimental spectrum Δ : set of possible ion types m: parent mass Output: A peptide with mass m, whose theoretical spectrum matches the experimental S spectrum the best

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Peptide Identification Problem Goal: Find a peptide from the database with maximal match between an experimental and theoretical spectrum. Input: S: experimental spectrum database of peptides Δ : set of possible ion types m: parent mass Output: A peptide of mass m from the database whose theoretical spectrum matches the experimental S spectrum the best

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info De novo Peptide Sequencing Problem=Protein Identification Problem in the Database of ALL Peptides Although de novo peptide sequencing problem seems to be more difficult that peptide identification problem, the algorithms for the former problem are actually much faster!

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info MS/MS Database Search Database search in mass-spectrometry has been very successful in identification of already known proteins. Experimental spectrum can be compared with theoretical spectra of database peptides to find the best fit. SEQUEST (Yates et al., 1995) But reliable algorithms for identification of modified peptides is a much more difficult problem.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Functional Proteomics Problem: Given a large collection of uninterpreted spectra, find out which spectra correspond to similar peptides. A method that cross-correlates related spectra (e.g., from normal and diseased individuals) would be valuable in functional proteomics.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info The dynamic nature of the proteome The proteome of the cell is changing Various extra-cellular, and other signals activate pathways of proteins. A key mechanism of protein activation is post-translational modification (PTM) These pathways may lead to other genes being switched on or off Mass spectrometry is key to probing the proteome and detecting PTMs

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Post-Translational Modifications Proteins are involved in cellular signaling and metabolic regulation. They are subject to a large number of biological modifications. Almost all protein sequences are post- translationally modified and 200 types of modifications of amino acid residues are known.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Examples of Post-Translational Modification Post-translational modifications increase the number of “letters” in amino acid alphabet and lead to a combinatorial explosion in both database search and de novo approaches.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Sequencing of Modified Peptides De novo peptide sequencing is invaluable for identification of unknown proteins: However, de novo algorithms are designed for working with high quality spectra with good fragmentation and without modifications. Another approach is to compare a spectrum against a set of known spectra in a database.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Search for Modified Peptides: Virtual Database Approach Yates et al.,1995: an exhaustive search in a virtual database of all modified peptides. Exhaustive search leads to a large combinatorial problem, even for a small set of modifications types. Problem (Yates et al.,1995). Extend the virtual database approach to a large set of modifications.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Exhaustive Search for modified peptides. YFDSTDYNMAK 2 5 =32 possibilities, with 2 types of modifications! Phosphorylation? Oxidation? For each peptide, generate all modifications. Score each modification.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Peptide Identification Problem Revisited Goal: Find a peptide from the database with maximal match between an experimental and theoretical spectrum. Input: S: experimental spectrum database of peptides Δ : set of possible ion types m: parent mass Output: A peptide of mass m from the database whose theoretical spectrum matches the experimental S spectrum the best

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Modified Peptide Identification Problem Goal: Find a modified peptide from the database with maximal match between an experimental and theoretical spectrum. Input: S: experimental spectrum database of peptides Δ : set of possible ion types m: parent mass Parameter k (# of mutations/modifications) Output: A peptide of mass m that is at most k mutations/modifications apart from a database peptide and whose theoretical spectrum matches the experimental S spectrum the best

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Database Search: Sequence Analysis vs. MS/MS Analysis Sequence analysis: similar peptides (that a few mutations apart) have similar sequences MS/MS analysis: similar peptides (that a few mutations apart) have dissimilar spectra

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Peptide Identification Problem: Challenge Very similar peptides may have very different spectra! Goal: Define a notion of spectral similarity that correlates well with the sequence similarity. If peptides are a few mutations/modifications apart, the spectral similarity between their spectra should be high.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Deficiency of the Shared Peaks Count Shared peaks count (SPC): intuitive measure of spectral similarity. Problem: SPC diminishes very quickly as the number of mutations increases. Only a small portion of correlations between the spectra of mutated peptides is captured by SPC.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info SPC Diminishes Quickly S(PRTEIN) = {98, 133, 246, 254, 355, 375, 476, 484, 597, 632} S(PRTEYN) = {98, 133, 254, 296, 355, 425, 484, 526, 647, 682} S(PGTEYN) = {98, 133, 155, 256, 296, 385, 425, 526, 548, 583} no mutations SPC=10 1 mutation SPC=5 2 mutations SPC=2

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Spectral Convolution

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Elements of S 2 S 1 represented as elements of a difference matrix. The elements with multiplicity >2 are colored; the elements with multiplicity =2 are circled. The SPC takes into account only the red entries

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Spectral Convolution x Spectral Convolution: An Example

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Spectral Comparison: Difficult Case S = {10, 20, 30, 40, 50, 60, 70, 80, 90, 100} Which of the spectra S’ = {10, 20, 30, 40, 50, 55, 65, 75,85, 95} or S” = {10, 15, 30, 35, 50, 55, 70, 75, 90, 95} fits the spectrum S the best? SPC: both S’ and S” have 5 peaks in common with S. Spectral Convolution: reveals the peaks at 0 and 5.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Spectral Comparison: Difficult Case S S’ S S’’

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Limitations of the Spectrum Convolutions Spectral convolution does not reveal that spectra S and S’ are similar, while spectra S and S” are not. Clumps of shared peaks: the matching positions in S’ come in clumps while the matching positions in S” don't. This important property was not captured by spectral convolution.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Shifts A = {a 1 < … < a n } : an ordered set of natural numbers. A shift (i,  ) is characterized by two parameters, the position ( i ) and the length (  ). The shift (i,  ) transforms {a 1, …., a n } into {a 1, ….,a i-1,a i + ,…,a n +  }

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Shifts: An Example The shift (i,  ) transforms {a 1, …., a n } into {a 1, ….,a i-1,a i + ,…,a n +  } e.g shift (4, -5) shift (7,-3)

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Spectral Alignment Problem Find a series of k shifts that make the sets A={a 1, …., a n } and B={b 1,….,b n } as similar as possible. k -similarity between sets D(k) - the maximum number of elements in common between sets after k shifts.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Representing Spectra in 0-1 Alphabet Convert spectrum to a 0-1 string with 1s corresponding to the positions of the peaks.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Comparing Spectra=Comparing 0-1 Strings A modification with positive offset corresponds to inserting a block of 0s A modification with negative offset corresponds to deleting a block of 0s Comparison of theoretical and experimental spectra (represented as 0-1 strings) corresponds to a (somewhat unusual) edit distance/alignment problem where elementary edit operations are insertions/deletions of blocks of 0s Use sequence alignment algorithms!

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Spectral Alignment vs. Sequence Alignment Manhattan-like graph with different alphabet and scoring. Movement can be diagonal (matching masses) or horizontal/vertical (insertions/deletions corresponding to PTMs). At most k horizontal/vertical moves.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Spectral Product A={a 1, …., a n } and B={b 1,…., b n } Spectral product A  B : two-dimensional matrix with nm 1s corresponding to all pairs of indices (a i,b j ) and remaining elements being 0s  SPC: the number of 1s at the main diagonal.  -shifted SPC: the number of 1s on the diagonal (i,i+  )

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Spectral Alignment: k -similarity k -similarity between spectra: the maximum number of 1s on a path through this graph that uses at most k+1 diagonals. k -optimal spectral alignment = a path. The spectral alignment allows one to detect more and more subtle similarities between spectra by increasing k.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info SPC reveals only D(0)=3 matching peaks. Spectral Alignment reveals more hidden similarities between spectra: D(1)=5 and D(2)=8 and detects corresponding mutations. Use of k-Similarity

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Black line represent the path for k=0 Red lines represent the path for k=1 Blue lines (right) represents the path for k=2

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Spectral Convolution’ Limitation The spectral convolution considers diagonals separately without combining them into feasible mutation scenarios. D(1) =10 shift function score = 10 D(1) = 

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Dynamic Programming for Spectral Alignment D ij (k) : the maximum number of 1s on a path to (a i,b j ) that uses at most k+1 diagonals. Running time: O(n 4 k)

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Edit Graph for Fast Spectral Alignment diag(i,j) – the position of previous 1 on the same diagonal as (i,j)

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Fast Spectral Alignment Algorithm Running time: O(n 2 k)

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Spectral Alignment: Complications Spectra are combinations of an increasing (N- terminal ions) and a decreasing (C-terminal ions) number series. These series form two diagonals in the spectral product, the main diagonal and the perpendicular diagonal. The described algorithm deals with the main diagonal only.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Spectral Alignment: Complications Simultaneous analysis of N- and C-terminal ions Taking into account the intensities and charges Analysis of minor ions

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Filtration: Combining de novo and Database Search in Mass-Spectrometry So far de novo and database search were presented as two separate techniques Database search is rather slow: many labs generate more than 100,000 spectra per day. SEQUEST takes approximately 1 minute to compare a single spectrum against SWISS-PROT (54Mb) on a desktop. It will take SEQUEST more than 2 months to analyze the MS/MS data produced in a single day. Can slow database search be combined with fast de novo analysis?

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Why Filtration ? Scoring Protein Query Sequence Alignment – Smith Waterman Algorithm Sequence matches Protein Sequences Filtration Filtered Sequences Sequence Alignment – BLAST Database actgcgctagctacggatagctgatcc agatcgatgccataggtagctgatcc atgctagcttagacataaagcttgaat cgatcgggtaacccatagctagctcg atcgacttagacttcgattcgatcgaat tcgatctgatctgaatatattaggtccg atgctagctgtggtagtgatgtaaga BLAST filters out very few correct matches and is almost as accurate as Smith – Waterman algorithm. Database actgcgctagctacggatagctgatcc agatcgatgccataggtagctgatcc atgctagcttagacataaagcttgaat cgatcgggtaacccatagctagctcg atcgacttagacttcgattcgatcgaat tcgatctgatctgaatatattaggtccg atgctagctgtggtagtgatgtaaga

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Filtration and MS/MS Scoring MS/MS spectrum Peptide Sequencing – SEQUEST / Mascot Sequence matches Peptide Sequences Filtration Peptide Sequences Database MDERHILNMKLQWVCSDLPT YWASDLENQIKRSACVMTLA CHGGEMNGALPQWRTHLLE RTYKMNVVGGPASSDALITG MQSDPILLVCATRGHEWAILF GHNLWACVNMLETAIKLEGVF GSVLRAEKLNKAAPETYIN..

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Filtration in MS/MS Sequencing Filtration in MS/MS is more difficult than in BLAST. Early approaches using Peptide Sequence Tags were not able to substitute the complete database search. Current filtration approaches are mostly used to generate additional identifications rather than replace the database search. Can we design a filtration based search that can replace the database search, and is orders of magnitude faster?

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Asking the Old Question Again: Why Not Sequence De Novo? De novo sequencing is still not very accurate! Algorithm Amino Acid Accuracy Whole Peptide Accuracy Lutefisk (Taylor and Johnson, 1997) SHERENGA (Dancik et. al., 1999) Peaks (Ma et al., 2003) PepNovo (Frank and Pevzner, 2005)

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info So What Can be Done with De Novo? Given an MS/MS spectrum: Can de novo predict the entire peptide sequence? Can de novo predict partial sequences? Can de novo predict a set of partial sequences, that with high probability, contains at least one correct tag? A Covering Set of Tags - No! (accuracy is less than 30%). - No! (accuracy is 50% for GutenTag and 80% for PepNovo ) - Yes!

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Peptide Sequence Tags A Peptide Sequence Tag is short substring of a peptide. Example: G V D L K G V DG V D V D L D L KD L K Tags:

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Filtration with Peptide Sequence Tags Peptide sequence tags can be used as filters in database searches. The Filtration: Consider only database peptides that contain the tag (in its correct relative mass location). First suggested by Mann and Wilm (1994). Similar concepts also used by: GutenTag - Tabb et. al MultiTag - Sunayev et. al OpenSea - Searle et. al

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Why Filter Database Candidates? Filtration makes genomic database searches practical (BLAST). Effective filtration can greatly speed-up the process, enabling expensive searches involving post-translational modifications. Goal: generate a small set of covering tags and use them to filter the database peptides.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Tag Generation - Global Tags Parse tags from de novo reconstruction. Only a small number of tags can be generated. If the de novo sequence is completely incorrect, none of the tags will be correct. W R A C V G E K D W L P T L T AVGELTK TAG Prefix Mass AVG 0.0 VGE 71.0 GEL ELT LTK 356.2

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Tag Generation - Local Tags Extract the highest scoring subspaths from the spectrum graph. Sometimes gets misled by locally promising-looking “garden paths”. W R A C V G E K D W L P T L T TAG Prefix Mass AVG 0.0 WTD PET 211.4

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Ranking Tags Each additional tag used to filter increases the number of database hits and slows down the database search. Tags can be ranked according to their scores, however this ranking is not very accurate. It is better to determine for each tag the “probability” that it is correct, and choose most probable tags.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Reliability of Amino Acids in Tags For each amino acid in a tag we want to assign a probability that it is correct. Each amino acid, which corresponds to an edge in the spectrum graph, is mapped to a feature space that consists of the features that correlate with reliability of amino acid prediction, e.g. score reduction due to edge removal

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Score Reduction Due to Edge Removal The removal of an edge corresponding to a genuine amino acid usually leads to a reduction in the score of the de novo path. However, the removal of an edge that does not correspond to a genuine amino acid tends to leave the score unchanged. W R A C V G K D W L P T L T W R A C V G K D W L P T L T W R A C V G K D W L P T L T E W W R A C V G K D L P T L T

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Probabilities of Tags How do we determine the probability of a predicted tag ? We use the predicted probabilities of its amino acids and follow the concept: a chain is only as strong as its weakest link

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Experimental Results Results are for 280 spectra of doubly charged tryptic peptides from the ISB and OPD datasets. Length 3Length 4Length 5 Algorithm \ #tags GlobalTag LocalTag GutenTag

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Tag-based Database Search Tag filterSignificanceScore Tag extension De novo Db 55M peptides Candidate Peptides (700)

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Matching Multiple Tags Matching of a sequence tag against a database is fast Even matching many tags against a database is fast k tags can be matched against a database in time proportional to database size, but independent of the number of tags. keyword trees (Aho-Corasick algorithm) Scan time can be amortized by combining scans for many spectra all at once. build one keyword tree from multiple spectra

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Keyword Trees YAK S N N F F AT YFAK YFNS FNTA …..Y F R A Y F N T A…..

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Tag Extension FilterSignificanceScoreExtension De novo Db 55M peptides Candidate Peptides (700)

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Given: tag with prefix and suffix masses xyz match in the database Compute if a suffix and prefix match with allowable modifications. Compute a candidate peptide with most likely positions of modifications (attachment points). Fast Extension xyz

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Scoring Modified Peptides FilterSignificanceScoreExtension De novo Db 55M peptides

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Scoring Input: Candidate peptide with attached modifications Spectrum Output: Score function that normalizes for length, as variable modifications can change peptide length.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Assessing Reliability of Identifications FilterSignificanceScoreextension De novo Db 55M peptides

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Selecting Features for Separating Correct and Incorrect Predictions Features: Score S: as computed Explained Intensity I: fraction of total intensity explained by annotated peaks. b-y score B: fraction of b+y ions annotated Explained peaks P: fraction of top 25 peaks annotated. Each of I,S,B,P features is normalized (subtract mean and divide by s.d.) Problem: separate correct and incorrect identifications using I,S,B,P

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Separating power of features

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Separating power of features Quality scores: Q = w I I + w S S + w B B + w P P The weights are chosen to minimize the mis-classification error

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Distribution of Quality Scores

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Results on ISB data-set All ISB spectra were searched. The top match is valid for 2978 spectra (2765 for Sequest) InsPecT-Sequest: 644 spectra (I-S dataset) Sequest-InsPecT: 422 spectra (S-I dataset) Average explained intensity of I-S = 52% Average explained intensity of S-I = 28% Average explained intensity I  S = 58% ~70 Met. Oxidations Run time is 0.7 secs. per spectrum (2.7 secs. for Sequest)

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Results for Mus-IMAC data-sets The Alliance for Cellular signalling is looking at proteins phosphorylated in specific signal transduction pathways spectra are searched with upto 4 modifications (upto 3 Met. Oxidation and upto 2 Phos.) 281 phosphopeptides with P-value < 0.05

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Filtration Results The search was done against SWISS-PROT (54Mb). With 10 tags of length 3: The filtration is 1500 more efficient. Less than 4% of spectra are filtered out. The search time per spectrum is reduced by two orders of magnitude as compared to SEQUEST. PTMsTag Length # TagsFiltrationInsPecT Runtime SEQUEST Runtime None313.4× sec> 1 minute × sec Phosphory lation 315.8× sec> 2 minutes × sec

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Conclusion With 10 tags of length 3: The filtration is 1500 more efficient than using only the parent mass alone. Less than 4% of the positive peptides are filtered out. The search time per spectrum is reduced from over a minute (SEQUEST) to 0.4 seconds.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info SPIDER: Yet Another Application of de novo Sequencing Suppose you have a good MS/MS spectrum of an elephant peptide Suppose you even have a good de novo reconstruction of this spectra However, until elephant genome is sequenced, it is hard to verify this de novo reconstruction Can you search de novo reconstruction of a peptide from elephant against human protein database? SPIDER (Han, Ma, Zhang ) addresses this comparative proteomics problem Slides from Bin Ma, University of Western Ontario

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Common de novo sequencing errors GG N and GG have the same mass

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info From de novo Reconstruction to Database Candidate through Real Sequence Given a sequence with errors, search for the similar sequences in a DB. (Seq) X: LSCFAV (Real) Y: SLCFAV (Match) Z: SLCF-V sequencing error (Seq) X: LSCF-AV (Real) Y: EACF-AV (Match) Z: DACFKAV mass(LS)=mass(EA) Homology mutations

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Alignment between de novo Candidate and Database Candidate If real sequence Y is known then: d(X,Z) = seqError(X,Y) + editDist(Y,Z) (Seq) X: LSCF-AV (Real) Y: EACF-AV (Match) Z: DACFKAV

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Alignment between de novo Candidate and Database Candidate If real sequence Y is known then: d(X,Z) = seqError(X,Y) + editDist(Y,Z) If real sequence Y is unknown then the distance between de novo candidate X and database candidate Z: d(X,Z) = min Y ( seqError(X,Y) + editDist(Y,Z) ) (Seq) X: LSCF-AV (Real) Y: EACF-AV (Match) Z: DACFKAV

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Alignment between de novo Candidate and Database Candidate If real sequence Y is known then: d(X,Z) = seqError(X,Y) + editDist(Y,Z) If real sequence Y is unknown then the distance between de novo candidate X and database candidate Z: d(X,Z) = min Y ( seqError(X,Y) + editDist(Y,Z) ) Problem: search a database for Z that minimizes d(X,Z) The core problem is to compute d(X,Z) for given X and Z. (Seq) X: LSCF-AV (Real) Y: EACF-AV (Match) Z: DACFKAV

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Computing seqError(X,Y) Align X and Y (according to mass). A segment of X can be aligned to a segment of Y only if their mass is the same! For each erroneous mass block (X i,Y i ), the cost is f(X i,Y i )=f(mass(X i )). f(m) depends on how often de novo sequencing makes errors on a segment with mass m. seqError(X,Y) is the sum of all f(mass(X i )). X Y Z seqError editDist (Seq) X: LSCFAV (Real) Y: EACFAV

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Computing d(X,Z) Dynamic Programming: Let D[i,j]=d(X[1..i], Z[1..j]) We examine the last block of the alignment of X[1..i] and Z[1..j]. (Seq) X: LSCF-AV (Real) Y: EACF-AV (Match) Z: DACFKAV

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Dynamic Programming: Four Cases Cases A, B, C - no de novo sequencing errors Case D: de novo sequencing error D[i,j]=D[i,j-1]+indel D[i,j]=D[i-1,j]+indel D[i,j]=D[i-1,j-1]+dist(X[i],Z[j])D[i,j]=D[i’-1,j’-1]+alpha(X[i’..i],Z[j’..j]) D[i,j] is the minimum of the four cases.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Computing alpha(.,.) alpha(X[i’..i],Z[j’..j]) = min m(y)=m(X[i’..i]) [seqError (X[i’..i],y)+editDist(y,Z[j’..j])] = min m(y)=m[i’..i] [f(m[i’..i])+editDist(y,Z[j’..j])]. = f(m[i’..i]) + min m(y)=m[i’..i] editDist(y,Z[j’..j]). This is like to align a mass with a string. Mass-alignment Problem: Given a mass m and a peptide P, find a peptide of mass m that is most similar to P (among all possible peptides)

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Solving Mass-Alignment Problem

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Improving the Efficiency Homology Match mode: Assumes tagging (only peptides that share a tag of length 3 with de novo reconstruction are considered) and extension of found hits by dynamic programming around the hits. Non-gapped homology match mode: Sequencing error and homology mutations do not overlap. Segment Match mode: No homology mutations. Exact Match mode: No sequencing errors and homology mutations.

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Experiment Result The correct peptide sequence for each spectrum is known. The proteins are all in Swissprot but not in Human database. SPIDER searches 144 spectra against both Swissprot and human databases

An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info Example Using de novo reconstruction X=CCQWDAEACAFNNPGK, the homolog Z was found in human database. At the same time, the correct sequence Y, was found in SwissProt database. Seq(X): CCQ[W ]DAEAC[AF] K Real(Y): CCK AD DAEAC FA VE GP K Database(Z): CCK[AD]DKETC[FA] K sequencing errors homology mutations