Globalnames.org.  Discovery  Ephemeral  Individualistic  Massive redundancy  Optional  Risk taking.

Slides:



Advertisements
Similar presentations
A vision for the future of taxonomic databases David Eades Illinois Natural History Survey Presented at the Natural History Museum, London, 17 January.
Advertisements

1 From Grids to Service-Oriented Knowledge Utilities research challenges Thierry Priol.
Preserving and Sharing Digital Data Greg Colati, Director, Archives and Special Collections May 11, 2012.
Cardiff School of Computer Science & Informatics Biodiversity Informatics at COMSC Andrew Jones & Richard White School of Computer Science & Informatics.
How to publish genomic Data papers based on BOL data - Biodiversity Data Journal Lyubomir Penev Bulgarian Academy of Sciences & Pensoft Publishers ViBRANT.
Use it or lose it: Crowdsourcing support and outreach activities in a hybrid sustainability model for e-infrastructures The ViBRANT project case studies.
Don’t make me think Biodiversity data publishing made easy Vince Smith, Alice Heaton, Laurence Livermore, Simon Rycroft, Ben Scott & Lyubomir Penev* The.
Pensoft Writing Tool (PWT) Lyubomir Penev ViBRANT Tools for DNA taxonomists, 11 June 2013, Brussles ViBRANT.
Virtualizing Entomology Collection Student: Di Wang (Alan) Sponsors: John Marris: Curator, Entomology Research Museum Stuart Charters: Department of Applied.
Integrated Taxonomic Information System Janet Gomon, Deputy Director, ITIS Smithsonian Institution Museum of Natural History The.
OpenUp! A New Project on Opening up the European Natural History Heritage for EUROPEANA W. G. Berendsohn, A. K. Michel, A. Güntsch, W.-H. Kusber (2011)
SinBIOTA 2.0: Planning a New Generation Environmental Information System Prof. Carlos A. Joly & Prof.João Meidanis University of Campinas & Scylla Bioinformatics.
Biodiversity Heritage Library by Connie Rinaldo. Overview History EOL/BHL: WHY? Members/Collaborators Process Governance Sustainability: Legal and Financial.
1 BrainWave Biosolutions Limited Accelerating Life Science Research through Technology.
Dimitris Koureas, Vince Smith & Simon Rycroft Natural History Museum London Linking data, services and communities using Virtual Research Environments.
GLOBAL BIODIVERSITY INFORMATION FACILITY David Remsen ECAT Program Officer September G A Darwin-Core Archive solution to publishing and.
BIS TDWG Conference 28 October 2013, Florence Documenting data quality in a global network: the challenge for GBIF Éamonn Ó Tuama, Andrea Hahn, Markus.
OpenUp! Natural History Heritage Information for Europeana Gerda Koch AIT-Angewandte Informationstechnik Forschungs-GmbH, Graz/Austria
Introduction to UDDI From: OASIS, Introduction to UDDI: Important Features and Functional Concepts.
Fourth Annual Summit | Feb | Tucson, AZ Scratchpads for community involvement for natural history collections Dr Dimitris Koureas Biodiversity.
Virtual Health Information Infrastructures: Scale and Scope Ann Séror, MBA, PhD 1 1 eResearch Collaboratory, Quebec City, QC, Canada, Url:
Training Course 2 User Module Training Course 3 Data Administration Module Session 1 Orientation Session 2 User Interface Session 3 Database Administration.
Nurturing a community based sustainability model Support and outreach structures in Scratchpads Livermore L. & Koureas D. Biodiversity Informatics Group.
Computer, what is the trajectory of the planet Seti Alpha 5?
IPlant's Taxonomic Name Resolution Service Naim Matasci BIO5 / The iPlant Collaborative tnrs.iplantc.org.
A Proposal for a Distributed Earth Observation Data Network Matthew B Jones UC Santa Barbara National Center for Ecological Analysis and Synthesis (NCEAS)
Common Names Services in OpenUp!
Hue University Rotifer Taxonomy workshop 6-12 March 2010 Global internet resources for taxonomists Hendrik S EGERS Belgian Biodiversity Platform Royal.
The Pensoft Journal System and XML-based workflow Lyubomir Penev Life and Literature Conference, Chicago 2011 ViBRANT Virtual Biodversity.
Online tools and standards for Biodiversity data in the Semantic Web Dr Dimitris Koureas Biodiversity Informatics Group | Department of Life Sciences The.
KEx objectives Supporting distributed and heterogeneous organizations in managing their knowledge processes, by technologically implementing the basic.
OBIS Portal Architecture Concepts plus potential for utilization as a basis for Regional OBIS Nodes Tony Rees, CSIRO Marine Research, Hobart (and OBIS.
Biodiversity Informatics Sarah Faulwetter Hellenic Centre for Marine Research.
Breakouts. Penguins: Skunks: Cacti: Beetles: Classroom A - Suzanne Classroom C - Chris Lecture Hall 2 - Connie Ward Lecture Hall - Marie (Theme: Content.
GLOBAL BIODIVERSITY INFORMATION FACILITY Cataloging and using Taxonomic Data The Global Names Architecture David Remsen Senior Programme Officer, ECAT.
The Global Names Architecture: Integration In Action (NOT “Inaction”) 1.Overview of GNA, GNI & GNUB (15 mins) 2.Questions, Elaborations & Clarifications.
19/10/20151 Semantic WEB Scientific Data Integration Vladimir Serebryakov Computing Centre of the Russian Academy of Science Proposal: SkTech.RC/IT/Madnick.
Biodiversity Data Journal: mobilization, reuse and integration of small data Lyubomir D. Penev 1,3, Teodor A. Georgiev 3, Pavel E. Stoev 2,3, Jordan Bisserkov.
Resolving the publishing bottleneck and increasing data interoperability in biodiversity science Lyubomir Penev, Teodor Georgiev, Pavel Stoev, David Roberts,
CYBERINFRASTRUCTURE FOR THE GEOSCIENCES Data Replication Service Sandeep Chandra GEON Systems Group San Diego Supercomputer Center.
A curation interface for reconciliation of species names for India. Thomas Vattakaven and R. Prabhakar, India Biodiversity Portal, Strand Life Sciences,
Scratchpads The virtual research environment for biodiversity data Simon Rycroft, Dave Roberts, Vince Smith, Alice Heaton, Katherine Bouton, Laurence Livermore,
Christina Flann Species 2000 October 2014 Catalogue of Life Indexing The World’s Known Species Connecting the taxonomic community and the names infrastructure.
GBIF Mid Term Meetings 2011 Biodiversity Data Portals for GBIF Participants: The NPT Global Biodiversity Information Facility (GBIF) 3 rd May 2011.
1 Of Crawlers, Portals, Mice and Men: Is there more to Mining the Web? Jiawei Han Simon Fraser University, Canada ACM-SIGMOD’99 Web Mining Panel Presentation.
Using the Global Change Master Directory (GCMD) to Promote and Discover ESIP Data, Services, and Climate Visualizations Presented by GCMD Staff January.
Global Biodiversity Information Facility GLOBAL BIODIVERSITY INFORMATION FACILITY Meredith A. Lane CODATA/ERPANET Workshop: Scientific Data Selection &
SKOS. Ontologies Metadata –Resources marked-up with descriptions of their content. No good unless everyone speaks the same language; Terminologies –Provide.
Identifying funding and collaboration opportunities to support the Global Names e-Infrastructure Dimitris Koureas & Vince Smith Natural History Museum.
BiodiversityWorld GRID Workshop NeSC, Edinburgh – 30 June and 1 July 2005 Taxonomic verification: Species 2000 and the Catalogue of Life Frank Bisby.
Rob Walker The INSPIRE metadata regulations and quality issues – a user view Rob Walker Association for Geographic Information, London.
Nikola Tesla Museum Clipping Library Saša Malkov Nenad Mitić Žarko Mijajlović 3 rd SEEDI Int.Conf. Cetinje, Montenegro 14. September 2007.
Scratchpads and the new Biodiversity Data Journal Biodiversity Data Publishing made… easier Dimitris Koureas Natural History Museum London.
Acronym Soup GBIF, TDWG & GUIDs Jerry Cooper. Global Biodiversity Information Facility (GBIF) Established in 2000 through non-binding MOU (25 countries.
Cyberinfrastructure Overview Russ Hobby, Internet2 ECSU CI Days 4 January 2008.
CAAB and taxon management at CSIRO Marine Research Tony Rees Divisional Data Centre CSIRO Marine Research, Hobart
Taxonomic Workflow in the EDIT Platform for Cybertaxonomy Andreas Kohlbecker, Pepe Ciardelli, Niels Hoffmann, Katja Luther, Andreas Müller Botanic Garden.
A Reference Model for RDA & Global Data Science Yin ChenWouter Los Cardiff University University of Amsterdam 1.
Global Change Master Directory (GCMD) Mission “To assist the scientific community in the discovery of Earth science data, related services, and ancillary.
International Oceanographic Data and Information Exchange - Ocean Data Portal (IODE ODP) Enabling science through seamless and open access to marine data.
Laura Russell VertNet Meherzad Romer NatureServe Canada John Wieczorek
GLOBAL BIODIVERSITY INFORMATION FACILITY David Remsen Senior Programme Officer, ECAT 3 Oct th Nodes Meeting.
GBIF Governing Board 20 Module 6B: New GBIF Tools II 2013 Portal and NPT Startup Daniel Amariles IT Leader, National Biodiversity Information System of.
Developing our Metadata: Technical Considerations & Approach Ray Plante NIST 4/14/16 NMI Registry Workshop BIPM, Paris 1 …don’t worry ;-) or How we concentrate.
Grid Services for Digital Archive Tao-Sheng Chen Academia Sinica Computing Centre
World wide access to biodiversity literature The Biodiversity Heritage Library Henning Scholz 1 & Tom Garnett 2 1 Museum für Naturkunde, Berlin, Germany.
Educational Portals Examples and Practices
RDA US Science workshop Arlington VA, Aug 2014 Cees de Laat with many slides from Ed Seidel/Rob Pennington.
Cataloging the Internet
Big Data Needs Little CRUD:
Presentation transcript:

globalnames.org

 Discovery  Ephemeral  Individualistic  Massive redundancy  Optional  Risk taking

 Discovery  Ephemeral  Individualistic  Massive redundancy  Optional  Risk taking  Implementation  Communal / agreed  Essential  Persistent  Robust & reliable  Adaptable

 Discovery  Ephemeral  Individualistic  Massive redundancy  Optional  Risk taking

Data re-use Data generation Data pool

AggregationVisualizationAnalysisManipulation ModelsObservationsExperimentsProcessed Data re-use Data generation Data pool

AggregationVisualizationAnalysisManipulation ModelsObservationsExperimentsProcessed Data re-use Data generation

 Can be used as metadata  To index content  A names-based cyberinfrastructure to index and interconnect distributed data 99

‘The initial mapping was constructed by extracting the scientific name of the taxon that was the topic of each Wikipedia page, then finding the match for this in the NCBI taxonomy’.

 Initiated by GBIF & EOL in 2007  To build a names-based cyberinfrastructure  An open and free virtual layer that interconnects and enriches distributed content  Shaped through Nomina workshops  Overseen by GNA Advisory panel  Globalnames.org

PIs:  Stan Blum, California Academy of Sciences Replication  Chris Freeland, Missouri Botanical Gardens / WUSTL BHL / CiteBank  David Patterson, Arizona State University Names services  Rich Pyle, Bishop Museum ZooBank / GNUB The “Global Names Architecture,” an innovative infrastructure for unifying nomenclatural and taxonomic databases and services for managers of biological information.

 Many names for one species  One name for many species  The indefinite nature of species  Classifications / phylogenies  Species without names

 Variant spellings (some legitimate, some mistakes)  Homotypic synonyms (= objective = nomenclatural)  Heterotypic synonyms (= subjective = taxonomic)  Common (plain language) names  Surrogates for names  Chresonyms

Didymosphenia geminata Echinella geminata Didymosphenia geminata (Lyngbye) D. geminata Didymosphenia geminata (Lyngbye) Schmidt 1899 Gomphonema vulgare Bréb. AAAAAGCTCGTAGTTGGATTTGTGAT GGAATTTGAATACTTTTAAAGTGTTCT AGAAACTGTCATCCGTGGGTGGAATT TGTTTGGCATTAGGTTGTCAGRCAGAG GATGCCTATMCTTTACTGTGAAAAAAT CAGTGCGTTCAAAGCAGACTTACGTC GATGAATGTATTAGCATGGAA Didimosphenia geminata didymo Rock Snot didymo

Didymosphenia geminata (Lyngbye) M.Schmidt in A. Schmidt 1899 Misspellings Didimosphenia geminata Lexical variants Didymosphenia geminata (Lyngbye) Didymosphenia geminata D. geminata D. geminata Schmidt 1899 D. geminata Schmidt Surrogates Homotypic Synonyms Echinella geminata Heterotypic Synonyms Gomphonema vulgare Bréb. Vernculars Didymo Rock Snot AAAAAGCTCGTAGTTGGATTTGTGATGGAATTTGAATACTTTTAAAGT GTTCTAGAAACTGTCATCCGTGGGTGGAATTTGTTTGGCATTAGGTTGT CAGRCAGAGGATGCCTATMCTTTACTGTGAAAAAATCAGTGCGTTCAAA GCAGACTTACGTCGATGAATGTATTAGCATGGAA

Gomphonema vulgare Brébisson 1838 G. vulgare Breb. Gomphonema vulgare Brébisson 1838 G. vulgare Breb. Vernaculars Surrogates RECONCILIATION GROUP AAAAAGCTCGTAGTTGGATTTGTGATGGAATTTGAATACTTTTAAAGTGTT CTAGAAACTGTCATCCGTGGGTGGAATTTGTTTGGCATTAGGTTGTCAGRC AGAGGATGCCTATMCTTTACTGTGAAAAAATCAGTGCGTTCAAAGCAGACTT ACGTCGATGAATGTATTAGCATGGAA Heterotypic synonyms

Gomphonema vulgare Brébisson 1838 G. vulgare Breb. Gomphonema vulgare Brébisson 1838 G. vulgare Breb. Vernaculars Surrogates AAAAAGCTCGTAGTTGGATTTGTGATGGAATTTGAATACTTTTAAAGTGTT CTAGAAACTGTCATCCGTGGGTGGAATTTGTTTGGCATTAGGTTGTCAGRC AGAGGATGCCTATMCTTTACTGTGAAAAAATCAGTGCGTTCAAAGCAGACTT ACGTCGATGAATGTATTAGCATGGAA Heterotypic synonyms RESOLUTION Didymosphenia geminata (Lyngbye) Schmidt 1899

 Using the name endorsed by your favored taxonomic source

 Aa  Ar  Pet1  A marina  Abe__Heli  Apodemia.mor.A13  N_larina_aethra_20018  Apion pensylvaticum: Boheman 1839  Apion pennsylvaticum Boheman, 1839  Gy091_Lv_Bonn_Ger  Gy642_Lv_Bas_Switz  P.potto_JCKerbis2889  S.sciereus_U53582  C.major  G.crass.  L._catta  L.catta Solution:  Taxonomic validation at point of data entry

 Focus on ‘Use Cases’  And the infrastructure will follow  Extend existing software, dbs and services around the concept of nodes  GN UUIDs for names and reconciliation groups  Exchange standards

 Particular  They represent a class of problems  Must be do-able  Must visibly benefit many end users  Must be openly available to use and to improve

 Taxonomic validation services. At point of data entry or with publishers. Requires Reconciliation and resolution.  Indexing. Using names recognition and discovery tools. Essential for name-linking services.  Names normalization – for data federation, but must deal with poor OCR, colloquial names in many languages etc.  Content synchrony and curation