How to use the NP search engine Sarah Alexander. The NP search engine I have created can be used to find any info you may need on breast cancer. This.

Slides:



Advertisements
Similar presentations
Decision Support Capability Breast Cancer Scenarios
Advertisements

Staying Up-To-Date Using Google Reader & RSS Feeds Christian Veillette M.D., M.Sc., FRCSC Assistant Professor, University of Toronto Shoulder & Elbow Reconstructive.
Wikis, and Voki, and Widgets! Oh My! … and Animoto!
Get a DNA sequence ncbi: national center for biotechnology informations nlm: national library of medicine nih: national institutes od health gov: US government.
Searching for Information Search engines vs. subscription services.
AHILA-WHO-INASP workshop Dar-es-Salaam, Tanzania, July 2005 Martha J Garrett, Director, INFORM Teaching materials.
MY NCBI To register, add filters and use the MY NCBI options, you should directly access PubMed using the following address:
MY NCBI To register, add filters and use the MY NCBI options, you should directly access PubMed using the following address:
HINARI/Health Information on the Internet (module 1.3 Part B)
Media Center Essential Question How can I be an effective user of information?
RSP Repository Services Day University of Nottingham, April 2008 Mary Robinson SHERPA European Development Officer SHERPA, University.
Do It Yourself – Roxana. 1.Photo Books 2.Picasa Application 3. YouTube Do It Yourself.
Introduction to the Internet
Surrey Libraries Computer Learning Centres January 2012 Internet Searching Teaching Script Totally New to Computers Internet Searching.
Is Human Intervention Really Necessary?. Basic Principles Originally in beta from Google uses same algorithm behind the regular search engine.
SEO Techniques for Creations. What is SEO? SEO stands for Search Engine Optimization Most popular search engines: Google Yahoo Ask MSN.
Infection Control Institutional Individual Community.
PubMed for Trainers, Winter 2013 U.S. National Library of Medicine (NLM) and NLM Training Center Full Text.
Tay-sachs-Disease By: Cory Hawkins & Tj Cartwright.
Alerts: Following your publications wherever they go How to create alerts using the following tools: – Google scholar
External Operating Experience Update Department of Energy Operating Experience Work Group January 14, 2014 Larry Stirling, Office of Analysis (HS-24)
Sexually Transmitted Diseases/Infections Assignment
Owen Coxall University of Oxford Bodleian Health Care Libraries Finding the Best Evidence.
Evaluating Web Resources. Author/Institution n Who is the author or Institution? n Biographical info given n Institution? n Information given about institution?
BLOSUM62. Sequencia desconhecida GTCACGTTACCGGTGGCCGAACAGGCCCGTCATGAAGTGTTCGATGTCGCGTCGGTCAGCGCGGCTGCCGCCCCAGTAAACA CCCTGCCGGTGACGACGCCGCAGAATTTGCAGACCGCCACTTACGGCAGCACGTTGAGTGGCGACAATCACAGTCGTCTGAT.
Information Literacy Government and Educational Websites Created by Alice Frye, Ph.D., Department of Psychology, University of Massachusetts, Lowell 1.
Patient Advocacy Bruce MacDonald JHYSF Meet the Sarcoma Experts MGH - Nov. 22, 2008.
Breast Cancer in African American Women
Klinefelter’s Syndrome By Greg Schreck and Troy Krause
Finding Information Created by Brian Gibbens, Ph.D.
What percentage of cancers are preventable? What percentage of cancers are preventable? Is breast cancer preventable? Is breast cancer preventable? Is.
MedlinePlus: Power Searching for Hidden Treasures An Infopeople Webinar Presented by Kelli Ham, MLIS August 21, 2014.
The journalist, the germ, the test tube and the public Julia Royall Chief, International Programs U.S. National Library of Medicine Fulbright Scholar to.
How to Create an MLA citation for a web document....
World Wide Web Basics Informatics Training for CDC Public Health Advisors.
Table of Contents: Part B  Internet Resources (a sampling of gateways and portals)  BookFinder  FreeBooks4Doctors.com  FreeBookCentre.net  Hesperian.
Free Authoritative Health Websites Emily Vardell, MLS
What is the NIH RePORTER? And How Will it Help My PI?
How she and her family learned about osteoporosis and bone health.
Health – Related Research Skills Are they important?
Internet Health Do’s, Don’ts and Tips. Do’s DO Look for the authors of the source or the original source of information; who wrote this and are they reputable?
Pharmacology & Prescribing Essential Drugs: Practical Guidelines International Drug Price Indicator Guide Merck Manuals WHO Model List of Essential Drugs.
Table of Contents: Part B  Internet Resources (a sampling of gateways and portals)  FreeBooks4Doctors.com  Hesperian Online Library  FreeBookCentre.net.
Keeping up with the well- informed patient: locating childhood cancer information on the Internet Ruti Volk, M.S.I. Program Coordinator Patient Education.
T HE F LORIDA S TATE U NIVERSITY C OLLEGE OF MEDICINE Educating and developing exemplary physicians who practice patient-centered health care T HE F LORIDA.
HINARI/Health Information on the Internet (module 1.3)
Websites, Research, and Accuracy Or can you always believe what you read on the internet?
Websites to check Professor Yee’s info transplantation/faculty/douglas-yee/index.htmhttp://
Well Woman Health Check & Breast and Cervical Cancer Treatment Programs Virginia Warren, MPH Office Chief of the ADHS Cancer Prevention & Control Programs.
Google Custom Search Engine Presented by David Bickford Director, Arizona Health Sciences Library at the Phoenix Biomedical Campus October 21, 2015.
We now view some Internet-based sources of E-books besides those available from HINARI. Using the Internet Addresses (url) at the top of the slides, you.
HINARI/Health Information on the Internet (module 1.3)
Business Web Design & Marketing Dignity for Children Students By Andrea Loh Lesson 3 Wordpress.
KASSIE M. OBELLEIRO FUNDING OPPORTUNITIES PROGRAM COORDINATOR Using E-media to Find Funding Opportunities April 25, 2012.
Content Syndication Resources from NLM, NIH, & HHS Brooke Dine (LO) and Elizabeth Norton (SIS) National Library of Medicine National Institutes of Health.
Teacher Tube Teacher tube is a great source for any digital media to use with your class. It is free to sign up, and you have access to many different.
The Internet.
HINARI/Health Information on the Internet (module 1.3)
Application of the Internet
Table of Contents: Part B
سرطان الثدي Breast Cancer
دانشکده پیراپزشکی گروه کتابداری و اطلاع رسانی پزشکی
Professional Organizations
How to Conduct Research
Understanding Health Research
Finding Good Research Sources
Internet Use.
Internet Vocabulary Terms
HEALTH RESEARCH PROJECT.
Presentation transcript:

How to use the NP search engine Sarah Alexander

The NP search engine I have created can be used to find any info you may need on breast cancer. This will come in handy during the breast cancer unit. Some of the topics that can be searched include: Breast cancer diagnosis (diagnostic tools) General breast cancer info Treatments Symptoms Stories from survivors

This is a sample of what a results page looks like

Sites that will be searched: – Centers for Disease Control (and Prevention) – Stories from survivorswww.breastcancerstories.org – Good site for checking symptoms, diagnostic tools, etc National Cancer Institute (National Institute of Health) – Website for all things breast cancerwww.breastcancer.org – National Center for Biotechnology Informationwww.ncbi.nlm.nih.gov

Code to embed this search engine in your page:

I hope this resource will be of help to future students. To make your own custom search, go to (make sure you have a google account- it’s free)

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2024 SlidePlayer.com. Inc. All rights reserved.