Slides to Accompany Artful Prior Art

Derwent GENESEQ Database Collection of patented DNA sequences –10 or more base pairs Coverage from 1981 Feb. 2001: 1,000,000 sequences Feb. 2002: 2,000,000 sequences Oct. 2003: 3,900,000 sequences

U.S. Patent No. 6,074, The purified preparation of claim 1 wherein the oligonucleotide comprises a contiguous sequence of at least 8 nucleotides complementary to either strand of the nucleotide residue sequence depicted in FIG. 62.

Figure 62 Strand A has 9,185 bases, beginning with: 5-CACTCCACCATGAATCACTCCCCTGTG AGGAACTACTGTCTTCACGCAGAAAGCGT CTAG…. Strand B is Strand As reverse complement. Claim covers 18,356 oligonucleotides (minus duplicates) But there are only 4 8 = 65,536 possible oligonucleotides with 8 bases!

What is Patented? An isolated and purified DNA molecule.

Why is it Patentable? Statutory law Case law –Patent Office Guidelines

35 U.S.C. § 101 (1952) Whoever invents or discovers any new and useful process, machine, manufacture, or combination of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.

35 U.S.C. § 103 (1952) (a) A patent may not be obtained … if the differences between the subject matter sought to be patented and the prior art are such that the subject matter as a whole would have been obvious at the time the invention was made to a person having ordinary skill in the art … (c) Patentability shall not be negatived by the manner in which the invention was made.

Patent-Defeating Disclosures A patent may not claim subject matter that was described in a printed publication –before the date of invention; or –more than one year before the application filing date. 35 U.S.C. § 102(a)

Some DNA Disclosure Programs Immediate publication of DNA sequences in public databases –Human Genome Project (Genbank) –Merck Gene Index (ESTs) Filing of statutory invention registrations: 35 U.S.C. § 157 –SNP Consortium

Limitations Publication of sequence information does not invalidate claims to subsequences per se Publication of ESTs does not invalidate claims to full-length genes or subsequences thereof –In re Deuel; In re Bell

Another Approach: Quiet Publication Is a doctoral thesis a printed publication under 102(b)? Yes, if it is publicly accessible. In re Hall. General library practice may be relied upon to establish an approximate time for thesis accessibility. Library directors affidavit: The dissertation most probably was available for general use toward the beginning of the month of December, 1977.

In re Hall An applicant has constructive knowledge of all properly indexed, cataloged and shelved library materials worldwide.

Described in a Printed Publication l To anticipate a claim to one or more chemical compounds, a single printed publication must: l specifically describe a compound within the scope of the claim l disclose a method of making the compound that enables one of ordinary skill in the art to do so l recite at least one significant useful property (§ 101 utility requirement need not be met) l It is not necessary that the disclosed compound actually have been made

Previous Work General methods of making and using oligonucleotides of arbitrary sequence are well known and described in the literature. But specific oligonucleotides are not described in this literature, so there is no § 102(a) bar

§ 102(a) Requirements A § 102(a) reference must include: –A specific description of the subject matter and –Instructions that will enable an ordinary practitioner to make and use the subject matter Not necessary to have actually made or used the subject matter A single copy in a public library counts as publication Solution: Describe 11 million DNA sequences, and general methods of making and using them, on a single CD-ROM

The CD-ROM On the Preparation and Utilization of Isolated and Purified Oligonucleotides As described in U.S. Patent No. 5,808,022 (issued Sept. 15, 1998) (William D. Huse), oligonucleotide synthesis proceeds via linear coupling of individual monomers in a stepwise reaction. The reactions are generally performed on a solid phase support...

The CD-ROM Based on the the disclosures herein and the knowledge of a person of ordinary skill in the art, it will be apparent to such a person how to make and use an isolated and/or purified oligonucleotide characterized by any of the following nucleotide sequences:

The CD-ROM 5'-AAACACCC-3' 5'-AAACACCG-3' 5'-AAACACGC-3' 5'-AAACACGG-3' 5'-AAACAGCC-3' 5'-AAACAGCG-3' 5'-AAACAGGC-3' 5'-AAACAGGG-3' 5'-AAACCACC-3'...

Anticipation of Oligonucleotide Patents # of 8-to-12 base oligonucleotides claimed % of possible claims anticipated 149.6% 274.6% 387.2% % %