BLOSUM62. Sequencia desconhecida GTCACGTTACCGGTGGCCGAACAGGCCCGTCATGAAGTGTTCGATGTCGCGTCGGTCAGCGCGGCTGCCGCCCCAGTAAACA CCCTGCCGGTGACGACGCCGCAGAATTTGCAGACCGCCACTTACGGCAGCACGTTGAGTGGCGACAATCACAGTCGTCTGAT.

Slides:



Advertisements
Similar presentations
Staying Up-To-Date Using Google Reader & RSS Feeds Christian Veillette M.D., M.Sc., FRCSC Assistant Professor, University of Toronto Shoulder & Elbow Reconstructive.
Advertisements

First, some basic info. What is iTunes U? What is a podcast?
The Arabidopsis Information Resource (TAIR)
MY NCBI (module 4.5). MODULE 4.5 PubMed/How to Use MY NCBI Instructions - This part of the: course is a PowerPoint demonstration intended to introduce.
MY NCBI To register, add filters and use the MY NCBI options, you should directly access PubMed using the following address:
PubMed/Filters (Limits) and Advanced Search (module 4.2)
MY NCBI To register, add filters and use the MY NCBI options, you should directly access PubMed using the following address:
MY NCBI (module 4.5). MODULE 4.5 PubMed/How to Use MY NCBI Instructions - This part of the: course is a PowerPoint demonstration intended to introduce.
MY NCBI (module 4.5). MODULE 4.5 PubMed/How to Use MY NCBI Instructions - This part of the: course is a PowerPoint demonstration intended to introduce.
The results for this search are displayed in the Summary format with a total of 3808 citations.
Genome Projects A genome project is the complete DNA sequence of the genome of an organism, and the identification of all its genes Genome projects are.
AIMSweb Benchmark Online Training For AIMSweb Teacher Users
Introduction to the Internet
HippoCampus A Free Educational Resource for Teachers.
CSNAV Milestone College List
Submitting a Genome to RAST. Uploading Your Job 1.Login to your RAST account. You will need to register if this is your first time using SEED technologies.
PubMed for Trainers, Winter 2013 U.S. National Library of Medicine (NLM) and NLM Training Center Full Text.
How to use the NP search engine Sarah Alexander. The NP search engine I have created can be used to find any info you may need on breast cancer. This.
Safer, Speedier and Sexier Surfing with Safari. Which Web Browser?
What is RefSeqGene?.
How to edit your company on LinkedIn.
Google Sketch-Up Tutorial By: Brittany Beckett. Installation Open a web browser. Go to sketchup.google.com.
INTRANET UPDATE DOWNLOAD AND SET UP GUIDE.
Databanks (A) NCBINCBI (National Center for Biotechnology Information) is a home for many public biological databases (see an older diagram below). All.
Site Navigation How to find your way around the ‘Agricultural Education and Training Archive’
Genomic Database - Ensembl Ka-Lok Ng Department of Bioinformatics Asia University.
Sequence-Structure-Function Sequence Structure Function Threading Ab initio BLAST Folding: impossible but for the smallest structures Function prediction.
Genome database & information system for Daphnia Don Gilbert, October 2002 Talk doc at
Remy Product Catalog Product Search/Cross References Product Details Application Search Model Search Service Parts.
Internet. Internet is Is a Global network Computers connected together all over that world. Grew out of American military.
Navigation Section 2. Objectives Student will knowhow to navigate through the browser.
GUIDED LESSON HYPERLINKS. OBJECTIVE In this lesson, you will learn the basics of working with hyperlinks, including how to insert and remove them in your.
SCPHCA Member Section Instructions How to manage your profile’s notification preferences.
Copyright OpenHelix. No use or reproduction without express written consent 2 Overview of Genome Browsers Materials prepared by Warren C. Lathe, Ph.D.
Use cases for Tools at the Bovine Genome Database Apollo and Bovine QTL viewer.
Copyright OpenHelix. No use or reproduction without express written consent1.
UCSC Genome Browser 1. The Progress 2 Database and Tool Explosion : 230 databases and tools 1996 : first annual compilation of databases and tools.
Toward a Unified Gene Page GMOD Meeting, April 2004 Don Gilbert,
The presentation will focus on searches that access the My Environment database. A simple tutorial of the basics on the website All of the demonstrations.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
1 MIP PALT Tool Training WebEx Training (2 hours) Introduction to the PALT Tool Monday 4/17/2006 & Tuesday 4/18/2006 Updated Monday 6/18/2007.
A Comparative Mapping Resource for Grains Gramene Navigation Tutorial Gramene v.19.1.
Annotation of Drosophila virilis Chris Shaffer GEP workshop, 2006.
ARGOS (A Replicable Genome InfOrmation System) for FlyBase and wFleaBase Don Gilbert, Hardik Sheth, Vasanth Singan { gilbertd, hsheth, vsingan
Copyright OpenHelix. No use or reproduction without express written consent1.
The Shaw Group Inc. WebVPN - Access Anywhere Users Manual.
Vocabulary 2 Internet Vocabulary. online On the internet.
Chapter 24. Copyright 2003, Paradigm Publishing Inc. CHAPTER 24 BACKNEXTEND 24-2 LINKS TO OBJECTIVES Document Map and Thumbnails Document Map and Thumbnails.
Copyright OpenHelix. No use or reproduction without express written consent1.
Genomes at NCBI. Database and Tool Explosion : 230 databases and tools 1996 : first annual compilation of databases and tools lists 57 databases.
Welcome to the combined BLAST and Genome Browser Tutorial.
Vocabulary 2 Internet Vocabulary. online On the internet.
7 Adding Signatures to s Step 1 Click on ‘Tools’ option in the toolbar at the top of the page. Click on ‘Options’
Download and install add-in Download and install office windows components from the following link Click Here.
Sequence-Structure-Function Sequence Structure Function Threading Ab initio BLAST Folding: impossible but for the smallest structures Function prediction.
Books Introduction A book provides a way to combine recordings into a user friendly web site, allowing the user to browse between recordings.
02/20/14 Mining Genomes - Tools of the Trade.
Annotating with GO: an overview
The Internet.
Bioinformatics Tools for Comparative Genomics of Vectors
~ How to create a basic website Part II ~
TSS Annotation Workflow
GEP Annotation Workflow
RIKEN Arabidopsis Transposon-tagged Mutant (RATM) Line Catalogue Database USER’S GUIDE.
Enter your gene of interest here
Internet Vocabulary Beth Felton McKelvey.
About CGD/ Getting Started
Printing Interim Reports
Presentation transcript:

BLOSUM62

Sequencia desconhecida GTCACGTTACCGGTGGCCGAACAGGCCCGTCATGAAGTGTTCGATGTCGCGTCGGTCAGCGCGGCTGCCGCCCCAGTAAACA CCCTGCCGGTGACGACGCCGCAGAATTTGCAGACCGCCACTTACGGCAGCACGTTGAGTGGCGACAATCACAGTCGTCTGAT TGCCGGTTATGGCAGTAACGAGACCGCTGGCAACCACAGTGATCTAATTGCCGGTTATGGAAGTACAGGCACCGCCGGCTAC GGCAGTACCCAGACTTCCGGAGAAGACAGCTCGCTCACAGCGGGTTACGGCAGCACGCAAACGGCTCAGGAAGGCAGCAATC TCACCGCTGGGTATGGCAGCACCGGCACGGCAGGCTCGGACAGCTCGTTGATCGCCGGTTATGGCAGTACACAAACCTCGGG AGGCGACAGTTCGCTGACCGCGGGCTACGGCAGTACGCAGACGGCCCAGGAGGGCAGCAATCTGACGGCGGGGTACGGCAGC ACGGGTACAGCAGGTGTCGACAGCTCTCTGATCGCGGGATACGGCAGCACGCAGACCTCGGGAAGTGACAGCGCCCTGACCG CAGGCTATGGCAGCACGCAAACGGCCCAGGAAGGCAGCAATCTCACTGCTGGGTATGGCAGCACCGGCACGGCAGGTTCCGA CAGCTCGCTGATCGCCGGTTACGGCAGCACGCAAACCTCGGGCAGTGACAGCTCGCTCACGGCGGGGTACGGCAGTACGCAG ACGGCTCAGGAAGGCAGCAATCTGACGGCGGGGTACGGCAGCACGGGTACAGCAGGTGTCGACAGTTCGTTGATCGCCGGAT ATGGCAGCACGCAGACCTCGGGAAGTGACAGTGCGCTGACAGCGGGTTACGGCAGCACGCAAACGGCCCAGGAAGGCAGCAA CCTGACGGCGGGCTACGGCAGCACTGGCACGGCAGGTGCCGACAGTTCGTTGATCGCCGGATATGGCAGCACGCAGACGTCA GGCAGCGAAAGTTCGCTTACCGCAGGCTATGGCAGTACCCAGACTGCCCGTGAGGGCAGCACCCTGACGGCCGGATATGGCA GTACCGGAACAGCTGGCGCTGACAGCTCGCTGATCGCCGGTTACGGCAGCACGCAAACCTCGGGCAGTGAAAGCTCGCTCAC GGCAGGTTATGGCAGTACCCAGACCGCACAGC

Bases de dados FlyBase FlyBase is the genomic repository for information for the model organism Drosophila melanogaster and many other related drosophilid species. Connect to FlyBase at and click on the GBrowse icon to access the Genome Browser.

Bases de dados WormBase WormBase is the repository for Caenorhabditis elegans and other worm model species genomic data. Connect to wormbase at Click on the “GBrowse” link in the Tool section at the top of the page to access the Genome Browser for C. elegans.

Bases de dados The Arabidopsis Information Resource As we’ve seen, TAIR is the repository for Arabidopsis genomic information. Connect to TAIR at and under the Tools tab, click on GBrowse.

Bases de dados NCBI One can also examine the human genome in a comparative manner using the NCBI map viewer application. Connect to the genomes section of the NCBI website at: and select the “Human Genome” link under the Custom Resources, then on the icons of the chromosomes for the most recent Map Viewer release (you used this in the first lab, too). Under Maps and Options, it is possible to select sequences from other species to display on the human Map Viewer

Bases de dados Mouse Genome Informatics – Comparative Genomics Example Connect to the Mouse Genome Informatics site at: Enter Pax6 into the Quick Search box at the top right.

Bases de dados WebACT 3. You can check out the similarities and differences of several precomputed genomic comparisons, using the prebuilt tool from the Sanger Institute.

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2024 SlidePlayer.com. Inc. All rights reserved.