Yupeng. Yeast surface Aga1p s s s s Aga2p I-AniI Myc 3’-ACTCCTCCAAAGAGACATT 5’-TGAGGAGGTTTCTCTGTAA Biotin Ani-wt: T G A G G A G G T T T C T C T G T A.

Slides:

Advertisements

Similar presentations

Monomerization of Homing Endonucleases Targets: CreI, MsoI, and CeuI. Goal: Generation of catalytically active monomeric HEs by connecting two copies of.

Advertisements

Selection of XID target site Ani-wt: T G A G G A G G T T T C T C T G T A A m-XID: A G T G C C T G T T T C T C T T G A C –7 –6 –5 -4 –3 –2 –1.

Expanding the Pool Characterizing LAGLIDADG Homing Endonuclease Orthologs.

Systematic Evolution of Ligands by Exponential Enrichment: RNA Ligands to Bacteriophage T4 DNA Polymerase CRAIG TUERK AND LARRY GOLD.

Putting biology to work for you: In vitro (directed) evolution and other techniques.

Selection of XID(Btk) site specific I-AniI variant for gene repair in hematopoietic stem cells Yupeng Wang Rawlings Lab Center for Immunity and Immunotherapy.

1 Directed Mutagenesis and Protein Engineering. 2 Mutagenesis Mutagenesis -> change in DNA sequence -> Point mutations or large modifications Point mutations.

Genetic Engineering Biotechnology Molecular Cloning Recombinant DNA.

DNA and Chromosome Structure. Chromosomal Structure of the Genetic Material.

Yeast & Cloning Sergio Peisajovich Lim Lab June 2007.

Above left: Chondroitin ABC lyase I from Proteus vulgaris Above right: The substrate binding domain from chondroitin ABC lyase I Below: The cycle of protein.

Scharenberg Lab Technical update on yeast display (Hoku/Jordan) –Overhang length can influence binding (see meeting notes) –Half sites can be interrogated.

Kyle Gribbin University of Oregon Mentor: Margarita Rojas PI: Alice Barkan.

Jonathan Sun University of Illinois at Urbana Champaign BIOE 506 February 15, 2010

I. Selections: I-AniI for wild-type site binding/cleavage: “WT-opt” (Ryo) I-AniI towards hCF (Audrey) I-AniI towards A.gam. CTLMA2 (Ryo) II. Binding specificity.

Copyright © 2010 Pearson Education, Inc. Lectures prepared by Christine L. Case Chapter 9 Biotechnology and Recombinant DNA.

Gene repair in murine hematopoietic stem cells (NGEC Component 6) Aim 1: Develop and test a murine X-linked severe combined immunodeficiency (XSCID) model.

Stoddard Lab Activities 1.Structural biology of design work: I-MsoI cluster designs vs. individual designs (Justin Ashworth and Greg Taylor) 2.Binding.

Genetics and Biotechnology

Gene repair in murine hematopoietic stem cells (NGEC Component 6) Aim 1: Develop murine X-linked severe combined immunodeficiency (XSCID) models for I-SceI.

Recombinant DNA Technology and Genomics A.Overview: B.Creating a DNA Library C.Recover the clone of interest D.Analyzing/characterizing the DNA - create.

Pattern Matching Rhys Price Jones Anne R. Haake. What is pattern matching? Pattern matching is the procedure of scanning a nucleic acid or protein sequence.

Reprogramming Bacteria to Seek and Destroy an Herbicide Presenters: Nahum Seifeselassie PJ Velez Shlomiya Bar-Yam Joy Sinha, Samuel J. Reyes, Justin P.

Transcription control elements (DNA sequences) are binding sites for transcription factors, proteins that regulate transcription from an associated.

Stoddard Lab Immediate Goals (Nov-Dec 2007) Optimization of I-AniI wild-type site recognition/I-AniI stability and generation of in vivo activity (bacterial.

Monnat Lab progress monomerizations of Cre, Mso (Hui) 2 nd round designs vs. Anopheles targets (Umut) in vivo recombination reporter assays (Ray, Hui)

Lecture # 04 Cloning Vectors.

YSD: Engineering Molecular Interactions Target protein is on the surface – biophysical characterization of binding by flow cytometry High-throughput &

High-Throughput Cloning and Expression Library Creation for Functional Proteomics The International Proteomics Tutorial Program.

Last Class 1. Transcription 2. RNA Modification and Splicing

DNA Technology and Genomics

Strategy of Redesign for CTLMA2 Target Site AniI WT: TGAGGAGGTTTCTCTGTAAA || | ||| ||||| || CTLMA2 : AGAAGCCGTTCATCTGTCAA -7A -10A/-7A -5C/-4C Semi-saturation.

WT#3#5#7#9#11#14#15#20#25#30 35S::JAZ13 Root length ratio * * * * * * * * * * Figure S2. Overexpression of native (untagged)

Recombinant DNA Reverse genetics Synthesis of DNA probes Restriction enzymes, plasmids and recombinant DNA Genomic and cDNA libraries Applications.

Affinity tuning of antibodies using yeast surface display.

Genome Analysis. This involves finding out the: order of the bases in the DNA location of genes parts of the DNA that controls the activity of the genes.

Sanger Method Frederick Sanger Radioactively labelled dNTPs or radioactive/fluorescent primers  Autoradiography, laser detector Chain Termination.

What is phage display? An in vitro selection technique using a peptide or protein genetically fused to the coat protein of a bacteriophage.

Lecture 8 A toolbox for mechanistic biologists (continued)

Biotechnology and Recombinant DNA

Biotechnology and Recombinant DNA

Monomerization of Homing Endonucleases

Fusion Proteins Fusion protein Cleavage of fusion proteins

Directed Mutagenesis and Protein Engineering

Transcription Translation Mutations rDNA Potpourri

Biotechnology and Recombinant DNA

Protein Engineering Protein engineering Industrial enzymes (Table 8.1)

Figure 2 Use of CRISPR/Cas9 for genome editing

Volume 17, Issue 12, Pages (December 2016)

Directed Mutagenesis and Protein Engineering

Volume 25, Issue 3, Pages (March 2017)

Genes Code for Proteins

Volume 154, Issue 6, Pages (September 2013)

Volume 7, Issue 1, Pages (April 2014)

Oligonucleotide aptamer-targeted immune modulation.

Molecular Therapy - Nucleic Acids

Raluca Ostafe, Radivoje Prodanovic, Jovana Nazor, Rainer Fischer

A Rare Case of Hypohidrotic Ectodermal Dysplasia Caused by Compound Heterozygous Mutations in the EDAR Gene Yutaka Shimomura, Nobuyuki Sato, Akinori.

RAD51 is essential for L. donovani.

Melissa S Jurica, Raymond J Monnat, Barry L Stoddard Molecular Cell

Volume 14, Issue 2, Pages (August 2008)

Tagging of the endogenous Py03652 gene with the gfp gene in Plasmodium yoelii. Tagging of the endogenous Py03652 gene with the gfp gene in Plasmodium yoelii.

Inactivation of the Dp1 locus.

Fig. 6. F1 trβ mutants accomplish natural metamorphosis.

A two-step method to flexibly engineer the fly genome.

RNA Repair: An Antidote to Cytotoxic Eukaryal RNA Damage

Systematic Study of Nucleosome-Displacing Factors in Budding Yeast

Hildegard Büning, Arun Srivastava

Knock-in of the rpl42-P56Q mutation using the split-ura4 system.

Presentation transcript:

Yupeng

Yeast surface Aga1p s s s s Aga2p I-AniI Myc 3’-ACTCCTCCAAAGAGACATT 5’-TGAGGAGGTTTCTCTGTAA Biotin Ani-wt: T G A G G A G G T T T C T C T G T A A m-XID: A G T G C C T G T T T C T C T T G A C m-wt: C –7 –6 –5 -4 –3 –2 – Engineering I-AniI HEs for XID site I-Anil Yeast surface display HA

Ani XID C terminal Design (Jim Havranek from Baker Lab) STS 3 STS 4 Ani XID C variants yeast surface expression. Myc-Ani

Vector digestion Yeast transformtion to establish Ani XID-C library (9×10 6 ) Six combo error prone PCR First round sorting based on Myc-Ani expression.

Second round sorting based on binding affinity toward Ani +6T+7G+9C. Ani wt oligo Ani XID oligo (+6T +7G +9C) Ani wt Library w/o sorting Ani-Myc sorting Ani XID +6T+7G+9C sorting Binding affinity of Ani variants toward Ani wt and Ani +6T+7G+9C oligos.

STS 3 STS 4 D Future experiments: Characterizing binding affinity and cleavage activity of individual variant. Engineering Ani XID N variants. JH Design Copy number Ani XID variants sequence analysis (45 variants) P JH Design Fold enrichment

Jordan

backbone groove mutated backbone mutated groovetargeted

90nM 25nM 15nM 4nM Ani WTE148DL156R E148D C150RK155N E148D C198R C150R I164V Q171HD173N C150S C198R CTD mutants of I-Ani1: Selection by YSD for higher affinity to target 10nM

YSD K d titration for Reo’s “Y2” mutant 90nM50nM10nM

Melissa

Current Projects  Expression of I-SceI (wt coding sequence) in S. cerevisiae  Design of REO-I-SceI (Restriction Enzyme- saturated ORF) for target of canine X-SCID site  Future projects: REO-I-CreI monomer and REO- I-MsoI monomer

Design of REO-I-SceI Optimized codon usage for S. cerevisiae expression Eliminated splice donors and acceptors Inserted silent restriction sites around desired motifs. I-SceI