Viral Evolution and Recombination Peter Norberg

Slides:

Advertisements

Similar presentations

LG 4 Outline Evolutionary Relationships and Classification

Advertisements

A Separate Analysis Approach to the Reconstruction of Phylogenetic Networks Luay Nakhleh Department of Computer Sciences UT Austin.

 Aim in building a phylogenetic tree is to use a knowledge of the characters of organisms to build a tree that reflects the relationships between them.

 Species evolve with significantly different morphological and behavioural traits due to genetic drift and other selective pressures.  Example – Homologous.

THE EVOLUTIONARY HISTORY OF BIODIVERSITY

Phylogenetic Trees Understand the history and diversity of life. Systematics. –Study of biological diversity in evolutionary context. –Phylogeny is evolutionary.

Phylogenetic reconstruction

Classification systems have changed over time as information has increased. Section 2: Modern Classification K What I Know W What I Want to Find Out L.

Molecular Evolution Revised 29/12/06

11.4. The Diversity of Species Result of the formation of different species How? A possible explanation: evolution through NATURAL SELECTION - Proposed.

BIOE 109 Summer 2009 Lecture 4- Part II Phylogenetic Inference.

Review of cladistic technique Shared derived (apomorphic) traits are useful in understanding evolutionary relationships Shared primitive (plesiomorphic)

Probabilistic methods for phylogenetic trees (Part 2)

Biology and the Tree of Life Chapter One. Key Concepts Organisms obtain and use energy are made up of cells, process information, replicate, and as populations.

Phylogeny Estimation: Traditional and Bayesian Approaches Molecular Evolution, 2003

Terminology of phylogenetic trees

Molecular phylogenetics

Population GENETICS.

Pathways of Evolution.

Molecular evidence for endosymbiosis Perform blastp to investigate sequence similarity among domains of life Found yeast nuclear genes exhibit more sequence.

SB3C. Examine the evolutionary basis of modern classification systems.

Objectives  Summarize Darwin’s theory of natural selection  Describe the evidence for evolution  SCS: B-5.

Chapter 26: Phylogeny and the Tree of Life Objectives 1.Identify how phylogenies show evolutionary relationships. 2.Phylogenies are inferred based homologies.

Evolution Chapters Evolution is both Factual and the basis of broader theory What does this mean? What are some factual examples of evolution?

Phylogenetic Analysis. General comments on phylogenetics Phylogenetics is the branch of biology that deals with evolutionary relatedness Uses some measure.

3- RIBOSOMAL RNA GENE RECONSTRUCITON  Phenetics Vs. Cladistics  Homology/Homoplasy/Orthology/Paralogy  Evolution Vs. Phylogeny  The relevance of the.

Bioinformatics 2011 Molecular Evolution Revised 29/12/06.

Underlying Principles of Zoology Laws of physics and chemistry apply. Principles of genetics and evolution important. What is learned from one animal group.

Molecular phylogenetics 4 Level 3 Molecular Evolution and Bioinformatics Jim Provan Page and Holmes: Sections

Phylogeny GENE why is coalescent theory important for understanding phylogenetics (species trees)? coalescent theory lets us test our assumptions.

17.2 Modern Classification

Phylogeny and Genome Biology Andrew Jackson Wellcome Trust Sanger Institute Changes: Type program name to start Always Cd to phyml directory before starting.

Agricultural Research Institute of the Hungarian Academy of Sciences Detecting inter- and intraspecific recombination events in plant RNA viruses with.

26.1 Organisms Evolve Through Genetic Change Occurring Within Populations. “Nothing in Biology makes sense except in the light of Evolution” –Theodosius.

Phylogenetic Analysis Gabor T. Marth Department of Biology, Boston College BI420 – Introduction to Bioinformatics Figures from Higgs & Attwood.

Recombination, Mutation, Genetic Drift, Gene Flow Also evolution Also evolution.

Chapter 10 Phylogenetic Basics. Similarities and divergence between biological sequences are often represented by phylogenetic trees Phylogenetics is.

© Colin Frayn, Speciation vs. Micro Evolution Micro evolution = change in allele frequency –E.g. disease resistance –E.g. moths in industrial.

Figure S1 Evolutionary relationships of RBG subclasses in Arabidopsis (a) and B. rapa (b). Optimal neighbor-joining trees with sum of branch lengths =

PHYLOGENY AND THE TREE OF LIFE CH 26. I. Phylogenies show evolutionary relationships A. Binomial nomenclature: – Genus + species name Homo sapiens.

Phylogenetic Trees - Parsimony Tutorial #13

Ayesha M.Khan Spring Phylogenetic Basics 2 One central field in biology is to infer the relation between species. Do they possess a common ancestor?

SC.912.L Mutations 2. Genetic Recombination (sexual reproduction)

Shai Carmi, Erez Levanon Bar-Ilan University

Systematics and Phylogenetics Ch. 23.1, 23.2, 23.4, 23.5, and 23.7.

Chapter 26 Phylogeny and Systematics. Tree of Life Phylogeny – evolutionary history of a species or group - draw information from fossil record - organisms.

Section 26.5: Horizontal Gene Transfer By Monica Macaro.

PHYOGENY & THE Tree of life Represent traits that are either derived or lost due to evolution.

Reference Text: Modern Biology Chapter 18 – Section 2 Modern Phylogenetic Taxonomy pgs

Chapter 26: Phylogeny and the Tree of Life

Molecular Clocks and Continued Research

Application of Phylogenetic Networks in Evolutionary Studies Daniel H. Huson and David Bryant Presented by Peggy Wang.

Taxonomy & Phylogeny. B-5.6 Summarize ways that scientists use data from a variety of sources to investigate and critically analyze aspects of evolutionary.

Announcements Seminar today after class! Seminar Wednesday!

Evolutionary genomics can now be applied beyond ‘model’ organisms

Sun et al Frontiers in zoology

1.6: Phylogenetic trees and cladograms are graphical representations (models) of evolutionary history that can be tested. 1. Phylogeny.

Higher Biology Genomic Sequencing Mr G R Davidson.

5.4 Cladistics.

Methods of molecular phylogeny

SB3C. Examine the evolutionary basis of modern classification systems.

Chapter 20 Phylogenetic Trees.

Phylogeny = evolutionary history of an organism;

Phylogeny and Systematics (Part 6)

Evidence for Evolution

Unit Genomic sequencing

Phylogeny and the Tree of Life

Chapter 18: Evolution and Origin of Species

Presentation transcript:

Viral Evolution and Recombination Peter Norberg

Phylogenetic analysis Reconstruction of evolutionary history Relationship Distance Common ancestors

Tree of Life

Viruses and Viral Evolution Viruses are not living organisms! but evolving… Genetic material (DNA or RNA) Need to adapt to their environment!

Different representations of phylogenetic trees A B CD A B C D A B C D A B C D A B C D

Bootstrap -A way to get “statistical significance” of a certain topology -Construct several new sequence sets (1000 st.) -A new sequence set is generated by randomly picking of columns from the original set -Apply the phylogenetic algorithm on all sets. -Make one consensus tree from all trees

Bootstrapping A: AACTTAACCACGCTATCGATGCAATTATATA B: AATTTGACTGCGGTACCGATCCAATTATATA C: AATTTGACTGGGCTACCGATCCAATTATATA D: AACTTAACCGCGCTACTGATCGAATTATATA A: CACC B: TGCT C: TGCT D: CAGC ADBCADBC 96 ABCDABCD 3 3 ACBDACBD 1 1

Recombination A powerful genetic mechanism Used by all animals (extremely few exceptions) Beneficial despite “the cost of sex” Speeds up evolution (up to 10,000 times) Accumulate beneficial mutations Expel deleterious mutations Bacteria through HGT Viruses!

Recombination

Recombination and phylogeny X A B C D E F G H I A B C D E F G H I H

X A B C D E F G H I H

Phylogenetic networks X A B C D E F G H I H

Methods for detection of recombinants -Detecting conflicting phylogenetic signals Phylogenetic networks (SplitsTree) Can be due to recombination or homoplasy

Phylogenetic network

Methods for detection of recombinants -Analyze conflicting phylogenetic signals, recombination vs homoplasy, and define breakpoints Bootscan (SimPlot) Similarity plots (SimPlot) Statistical tests (phi-test) RDP, Geneconv, MaxChi, Chimaera, SisScan, 3Sec, LARD, Topal, …. (RDP)

Bootscan