MITOGENOMICS AND MOLECULAR PHYLOGENETICS OF FISH BASED ON COMPLETE MITOCHONDRIAL GENOME SEQUENCES DATA Y.Ph. Kartavtsev A.V. Zhirmunsky Institute of Marine.

Slides:



Advertisements
Similar presentations
A quantitative trait locus not associated with cognitive ability in children: a failure to replicate Hill, L. et al.
Advertisements

Multistage Sampling.
1 Molecular epidemiology of lyssaviruses in Eurasia Dr Lorraine McElhinney Veterinary Laboratories Agency (Weybridge), UK.
Overview of Lecture Partitioning Evaluating the Null Hypothesis ANOVA
Your lecturer and course convener
Lecture 7 THE NORMAL AND STANDARD NORMAL DISTRIBUTIONS
Lecture 2 ANALYSIS OF VARIANCE: AN INTRODUCTION
The Human Genome Project Main reference: Nature (2001) 409,
1 Contact details Colin Gray Room S16 (occasionally) address: Telephone: (27) 2233 Dont hesitate to get in touch.
Andrew Meade School of Biological Sciences.
Projects in Computing and Information Systems A Student’s Guide
Chapter 7 Sampling and Sampling Distributions
Markov models and applications
Biostatistics Unit 5 Samples Needs to be completed. 12/24/13.
The basics for simulations
On Comparing Classifiers : Pitfalls to Avoid and Recommended Approach
Chapter 10: The t Test For Two Independent Samples
The Frequency Table or Frequency Distribution Table
SAFETY EFFECTS OF RESTRICTING THE SPEED LIMIT FROM 90 TO 70 KM/H Ellen De Pauw 1, Melissa Thierie 1, Stijn Daniels 1, Tom Brijs 1 1 Hasselt University,
Weighted moving average charts for detecting small shifts in process mean or trends The wonders of JMP 1.
Quantitative Analysis (Statistics Week 8)
Introduction to Feedback Systems / Önder YÜKSEL Bode plots 1 Frequency response:
Statistical Inferences Based on Two Samples
© The McGraw-Hill Companies, Inc., Chapter 10 Testing the Difference between Means and Variances.
Chapter Thirteen The One-Way Analysis of Variance.
1 Number of substitutions between two protein- coding genes Dan Graur.
©2006 Prentice Hall Business Publishing, Auditing 11/e, Arens/Beasley/Elder Audit Sampling for Tests of Controls and Substantive Tests of Transactions.
Experimental Design and Analysis of Variance
Simple Linear Regression Analysis
January Structure of the book Section 1 (Ch 1 – 10) Basic concepts and techniques Section 2 (Ch 11 – 15): Inference for quantitative outcomes Section.
CS 598AGB What simulations can tell us. Questions that simulations cannot answer Simulations are on finite data. Some questions (e.g., whether a method.
Genetics differentiation and systematic of peripheral populations of East Asian endemic rodent Myospalax psilurus (Rodentia, Spalacidae) M.V. Tsvirka,
Bioinformatics Phylogenetic analysis and sequence alignment The concept of evolutionary tree Types of phylogenetic trees Measurements of genetic distances.
Measuring the degree of similarity: PAM and blosum Matrix
1 General Phylogenetics Points that will be covered in this presentation Tree TerminologyTree Terminology General Points About Phylogenetic TreesGeneral.
Introduction to Bioinformatics
. Class 1: Introduction. The Tree of Life Source: Alberts et al.
Heuristic alignment algorithms and cost matrices
Maximum Likelihood. Historically the newest method. Popularized by Joseph Felsenstein, Seattle, Washington. Its slow uptake by the scientific community.
Molecular Evolution with an emphasis on substitution rates Gavin JD Smith State Key Laboratory of Emerging Infectious Diseases & Department of Microbiology.
Evaluating Hypotheses
Evolutionary Genome Biology Gabor T. Marth, D.Sc. Department of Biology, Boston College Medical Genomics Course – Debrecen, Hungary, May 2006.
Molecular Clocks, Base Substitutions, & Phylogenetic Distances.
Lecture 12 Splicing and gene prediction in eukaryotes
DIFFERENTIATION AND SYSTEMATICS IN THE LONG-TAILED GROUND SQUIRREL, SPERMOPHILUS UNDULATUS (SCIURIDAE, RODENTIA) Marina V. Tsvirka, Vladimir P. Korablev,
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.
MOLECULAR GENETIC RELATIONSHIPS OF THE ZOKORS (RODENTIA, MYOSPALACINAE): ANALYSIS OF D-LOOP REGION POLIMORPHISM Tsvirka Marina 1, Pavlenko Marina 1, Korablev.
Molecular evidence for endosymbiosis Perform blastp to investigate sequence similarity among domains of life Found yeast nuclear genes exhibit more sequence.
Tree Inference Methods
Molecular phylogenetics 4 Level 3 Molecular Evolution and Bioinformatics Jim Provan Page and Holmes: Sections
1 Evolutionary Change in Nucleotide Sequences Dan Graur.
Identifying and Modeling Selection Pressure (a review of three papers) Rose Hoberman BioLM seminar Feb 9, 2004.
Chapter 10 Phylogenetic Basics. Similarities and divergence between biological sequences are often represented by phylogenetic trees Phylogenetics is.
Ayesha M.Khan Spring Phylogenetic Basics 2 One central field in biology is to infer the relation between species. Do they possess a common ancestor?
Phylogenetic analysis of flatfish species (Teleostei, Pleuronectiformes) based on cytochrome oxidase 1 (Co-1) and cytochrome b (Cyt-b) genes Sharina S.N.,
Systematics and Phylogenetics Ch. 23.1, 23.2, 23.4, 23.5, and 23.7.
Evolutionary Genome Biology Gabor T. Marth, D.Sc. Department of Biology, Boston College
Modelling evolution Gil McVean Department of Statistics TC A G.
Substitution Matrices and Alignment Statistics BMI/CS 776 Mark Craven February 2002.
From: On the Origin of Darwin's Finches
MtActinopterygii: Analysing evolution of mitogenomes belonging to the most dominant class of vertebrates Sevgi Kaynar1, Esra Mine Ünal1, Tuğçe Aygen1,
Inferring a phylogeny is an estimation procedure.
Linkage and Linkage Disequilibrium
Maximum likelihood (ML) method
Distances.
Models of Sequence Evolution
Chapter 19 Molecular Phylogenetics
The Most General Markov Substitution Model on an Unrooted Tree
But what if there is a large amount of homoplasy in the data?
Phylogenetic tree representation of a neighbor-joining analysis of several species of piroplasms. Phylogenetic tree representation of a neighbor-joining.
Presentation transcript:

MITOGENOMICS AND MOLECULAR PHYLOGENETICS OF FISH BASED ON COMPLETE MITOCHONDRIAL GENOME SEQUENCES DATA Y.Ph. Kartavtsev A.V. Zhirmunsky Institute of Marine Biology of Far Eastern Branch of Russian Academy of Sciences, Vladivostok , Russia; Far Eastern Federal University, Vladivostok , Russia;

1. Comparative Mitogenomics: Introduction. 2. The Review of Literature Data on p- Distances. 3. Molecular Phylogenetics & DNA Barcoding. MAIN GOALS

Mitochondrion DNA (mtDNA) is a ring molecule of kilo-base pairs (kbp) in length. As literature data show, mtDNA of all fishes has similar organization (Lee et al., 2001; Kim et al., 2004; Kim et al., 2005; Nagase et al., 2005; Nohara et al., 2005) and small differences among all vertebrate animals, including men (Anderson et al., 1981; Bibb et al., 1981; Wallace, 1992; Kogelnik et al., 2005). The complete content of whole mitochondrial genome (mitogenome) includes: control region (CR or D loop), where the site of initiation of replication and promoters are located, big (16S) and small (12S) rRNA subunits, 22 tRNA and 13 polypeptide genes, total N= COMPARATIVE MITOGENOMICS: INTRODUCTION (1)

Fig a. Summary for the ANOVA two variable analysis: the plot of frequency distribution for the four nucleotides in torrent catfish, Liobagrus obesus. The difference between ND6 and 12 other protein genes nucleotide composition is illustrated. The total frequencies are shown for all 3 nucleotide positions in codons. Significance is shown on the top of the graph b. Plot of the average percentage at four nucleotides of flatfish species, order Pleuronectiformes (Groups 1-2) in comparison with representatives of Perciformes (3). Original data were taken from Table 2 for the Cyt-b gene at all three nucleotide positions. On the top results of one-factor MANOVA are given. Groups 1 to 3: 1 – Species from this study; 2 – Species taken from GenBank; 3 – GenBank data on Perciformes (From: Kartavtsev et al., 2007a, 2007b, Gene and Marine Biology). 1. COMPARATIVE MITOGENOMICS: INTRODUCTION (2) a b

Fig The control region (CR, 814 bp after alignment) and conserved sequences for the bullhead torrent catfish, Liobagrus obesus in comparison with three other catfish species. Aligned sequence features and conserved blocks are shown: TAS – strikeover letters, TATA-box – underlined letters, CSB1 – gray box, CSB2 – frame, and SCB3 – double frame (From: Kartavtsev et al., 2007a). 1. COMPARATIVE MITOGENOMICS: INTRODUCTION (3)

1. COMPARATIVE MITOGENOMICS: INTRODUCTION (4)

WHAT IS MAIN OUTCOME WHAT IS MAIN OUTCOME Mitogenome in vertebrates is very conservative (~16 KB long). In invertebrates it is much longer, up to KB. Mitogenome in vertebrates is very conservative (~16 KB long). In invertebrates it is much longer, up to KB. Most conservative is gene order. Most conservative is gene order. Still, there are flexible sections. Still, there are flexible sections. Unknown are nuclear vs. mitogenome exchange and interaction. Unknown are nuclear vs. mitogenome exchange and interaction. Many genes that known to be mitochondrial (Idh*, Mdh* etc.) are absent in mtDNA. Many genes that known to be mitochondrial (Idh*, Mdh* etc.) are absent in mtDNA. Contrary to that, some mtDNA genes (Cyt-b, Co-c) are active in nuclear background. There are mutations in mtDNA that create human deceases. There are mutations in mtDNA that create human deceases. Some mobile elements might be present in mitogenome. IS sections detected. Some mobile elements might be present in mitogenome. IS sections detected. 1. COMPARATIVE MITOGENOMICS: INTRODUCTION (5)

PHYLOGENETICS & DNA BARCODING MARKERS Usually in phylogenetic research single gene sequences are used for both mtDNA and nuclear genome. However, recently more and more frequent are become complete mitogenome usage. Most popular in phylogenetics are sequences of cytochrome b (Cyt-b) and cytochrome oxidase 1 (Cо-1) genes, which used for taxa comparison at the species - family level (Johns, Avise, 1998; Hebert et al., 2004; Kartavtsev, Lee, 2006; Kartavtsev, 2009). Many sequences that bringing the phylogenetic signal obtained for different taxa at gene 16S rRNA as well. Sequences of separate genes can have different phylogenetic signal because of differences in substitution rates. This is also true for different sections of genes. Also, under comparison of higher taxa there may be effects of homoplasy. When numerous taxa available there are problems of insufficient information capacity of sequences to cover big species diversity and adequate taxa representation is quite important (Hilish et al., 1996). Nevertheless, for the species identification, excluding rare cases, fine results are available even with the usage of short target sequences, like Со-1, with 650 bp.

Spacers [ITS-1, 2] mtDNA mtDNA nDNA, nDNA, rDNA rDNA Most substantiated statistically results Most substantiated statistically results Statistically significant results Statistically significant results Species Genus Family Order Class Phylum Applicability of Different DNA Types in Phylogenetics and Taxonomy

3.1. DIVERSITY AT DNA MARKERS WITHIN SPECIES AND IN TAXA OF DIFFERENT RANK. AN ANALYSIS OF EMPIRICAL DATA 2. THE REVIEW OF LITERATURE DATA ON P- DISTANCES

2.1. USING P-DISTANCES. SUMMARY To estimate the actual number of substitutions among sequences X and Y it is necessary to introduce a certain mathematical model. At least 8 major models (Nei, Kumar, 2000; Felsenstein, 2004) and 56 in total are referred in sources nowadays (Posada, 2005; ). Among most simple and known are Jukes, Cantor (1968; JC) and Kimura (1980) two parametric (K2P) models. The late is default in some packages (e.g. PAUP). These models consequently suggest the equality of all kinds of substitutions and non equality for transitions (α) and transversions (β). Titles of some other models: Equal-input, Tamura, HKY (Hasigawa-Kishino- Yano), Tamura-Nei (TrN), General time reversible (GTR), Unrestricted.

In the K2P model equilibrium frequencies of 4 nucleotides are However, the algorithms suggested for calculations (expected p^ and its variance) here and in Jukes-Cantor model are applicable irrelevant to frequency deviations (Rzhetsky, Nei, 1995). Thus, both models are suitable for wider range of conditions, where real parameters stay unknown. Be unconfused we should remember that in Kimura’s model ratio of transitions to transversions is R = α / 2β, however many authors and many software using different proportion - k = α / β. In our estimates (Kartavtsev, Lee, 2006) most authors using K2P (29%) and many using simple p^ or such measures as HKY, TrN etc. To choose an appropriate model there is a popular program MODELTEST (Posada, Grandal, 1998). Very useful info on model properties and their applicability over wide range of specific data sets may be find in literature (Nei, Kumar, 2000; Hall, 2001; Sanderson, Shaffer, 2002; Felsenstein, 2004) USING P-DISTANCES. SUMMARY

2.3. P-DISTANCE. SUMMARY p-Distance and others. p-distance is a fraction of different nucleotides in their total number for a pair of sequences. Numerical simulations showed that when p-distances are small, <20%, then any model give similar values of divergence (Fig. 1.1). Because of heterogeneity of substitution rates along sequences and different parts of genes an important correction of p-distance is gamma- correction (e.g. Nei, Kumar, 2000; Felsenstein, 2004). Fig Estimates of the number of nucleotide substitutions obtained by different distances measures when actual numbers follows TrN-model (From Nei, Kumar, 2000).

Intraspecies diversity In our data base for hundred intraspecies р-distances averages comprise at Cyt-b and Co-1: M=1.55± 0.56% and M=0.55± 0.19%, correspondingly (Kartavtsev, Lee, 2006). Most important thing that I like to stress here is that for many species a stable, geographically restricted intraspecies gatherings have been detected. They are marked by mtDNA genes and obviously there are isolated intraspecies phylogroups existing for many generations, which as real as real are the local stocks that defined by other biological methods. Number of such examples is summarized by Avise & Wolker (1999) and many also presented in our reviews (Kartavtsev, Lee, 2006, Kartavtsev, 2009). Among others may be mentioned bottle-nose dolphin, Tursiops truncatus (Dowlin, Brown, 1993), Canadian gees, Branta canadiensis (Van Wagner, Baker, 1990), fishes, Fundulus heteroclitus and Stizostedion vitreum (Gonzales-Willasefior, Powers, 1990, Billington, Strange, 1990) etc. (Stepien, Faber, 1998). There are many and variable estimates based on different markers. For instance, two copepod species obtained nucleotide diversity (π) dependent on latitude at rRNA gene of mtDNA. Subarctic species Calanus finmarchicus, π=0.37%, SD = 0.26, was less variable, than temperate water, Nanocalanus minor, π=0.50%, SD = 0.32 (Bucklin, Wiebe, 1998). If focus on Cyt-b and Co-1 sequence diversity, К2Р value at Со-1 at sequence some 600 bp was estimated for 107 intraspecies groups of different species for five families of baterfly (Lepidoptera: Arctidae, Geometridae, Noctuidae, Notodontidae, Sphingidae), as small (Hebert et al., 2002). For average values the variation is within limit: 0.17 – 0.36%. Our recalculation gives average for these groups: К2Р = 0.25 ± 0.04%.

p-DISTANCES IN GROUPS OF COMPARISON, Review 2 Plot of distribution of weighted mean p-distances among five groups of comparison at Cyt-b and Co-1 genes and 21,000 animal species. Groups here: 1. Intra- species, among individuals of the same species; 2. Intra-sibling species + semispecies + subspecies, 3. Intra-genus, among species of the same genera; 4. Intra-family, among genera of the same family, 5. Intra-oreder, families of the same order(From Kartavtsev, 2011a, Marine Genomics). Fig Plot of distribution of weighted mean p-distances among five groups of comparison at Cyt-b and Co-1 genes and 21,000 animal species. Groups here: 1. Intra- species, among individuals of the same species; 2. Intra-sibling species + semispecies + subspecies, 3. Intra-genus, among species of the same genera; 4. Intra-family, among genera of the same family, 5. Intra-oreder, families of the same order (From Kartavtsev, 2011a, Marine Genomics). Thus, data available suggest that in general a phyletic evolution prevail in animal world, and so far, the Geographic speciation events (Type 1a) most common in nature. Do data presented assume that speciation is always follows the Type 1a mode? I guess, no. Few examples below let to support this answer.

DISTANCE VS TAXA SPLITTING Has punctuation an impact in species origin on molecular level? Avise, Ayala, 1976; Kartavtsev et al., 1980; current – No. Pagel et al., 2006 – Yes. Number of Splittings Transformed p-distance r s = 0.22, p < 0.05 Fig Plot of p-distance on number of splittings at Cyt-b sequence data for catfishes and flatfishes

WHAT IS MAIN OUTCOME Distance measure alone is not satisfactory descriptor and they should be standartized. Data on intraspecies diversity (heterozygosity) at structural genes are necessary. Measures of regulatory genome changes should be necessary to describe transformative modes of speciation. Other descriptors of genomic change are required (e.g. chromoseme number, NF, transcription rate etc.).

3. MOLECULAR PHYLOGENETICS & DNA BARCODING

Identification + Taxonomy Historically # 1: Biochemical Systematics. DNA Barcoding Phylogenetics + Taxonomy Actually # 1: Basic Value. Dating of Splitting. 4. MOLECULAR PHYLOGENETICS & DNA BARCODING

Fig Maximum likelihood tree of the unambiguous aligned 14,293 nucleotide positions from 31 species/subspecies of Leuciscinae and 9 outgroup species based on heuristic search with the GTR+I+G model. 1st codon, 2nd codon, 3rd codon, tRNAs, rRNAs were separately analyzed; i.e., partitions were introduced in program settings. Numbers beside internal branches indicate bootstrap probabilities from 1,000 replicates. The scales in the left bottom corners indicate relative branch lengths (From: Imoto et al., 2013, Gene). RESULTS (1)

Fig Posterior distribution of divergence times as estimated among Leuciscinae species and related species. Horizontal bars represent the estimated 95% credibility intervals of divergence times (From: Imoto et al., 2013, Gene). RESULTS (2)

Fig Rooted consensus (50%) BA-tree, which shows molecular phylogenetic interrelationships for 25 mitogenome sequences of 13 structural genes. In the nodes the posterior BA probabilities for n=10 6 simulated generations and bootstrap support for ML (n=500), MP and NJ (n=1,000 for both) are shown (BA/ML/MP/NJ). BA and ML trees are based on GTR+I+G model. All structural genes used including ND6, no partitions introduced (From: Kartavtsev et al., 2013, in press). RESULTS (3)

Fig Combined phylogram of Co-1 and Cyt-b genes for 59 sequences of our and GenBank representatives of Glyptothorax catfish jointly with 3 outgroup specimens built by BA algorithm. In the nodes the support levels (Probabilities, %) are shown in order: BA, ML, MP, and NJ. Abbreviation 100 x 4 denotes: 100,100,100,100 and 100 x 3 denotes: 100,100,100 (From: Singh et al., 2013, submitted). RESULTS (4)

Fig Tanglegram built for Co-1 vs. Cyt-b genes as previously for 59 sequences of our and GenBank representatives of Glyptothorax catfish jointly with 3 outgroup specimens in two approaches depicted at A and B. At A the consensus tree made by LSA algorithm from 2 single gene trees is represented. At B the consensus tree built by BA algorithm from 2 partitions representing sequences of Co-1 plus Cyt-b is visualized. Lines show common tips defined by the heuristic algorithm in PP Dendroscope. T technique is used for building consensus tree in A (From: Singh et al., 2013, submitted). Fig Tanglegram built for Co-1 vs. Cyt-b genes as previously for 59 sequences of our and GenBank representatives of Glyptothorax catfish jointly with 3 outgroup specimens in two approaches depicted at A and B. At A the consensus tree made by LSA algorithm from 2 single gene trees is represented. At B the consensus tree built by BA algorithm from 2 partitions representing sequences of Co-1 plus Cyt-b is visualized. Lines show common tips defined by the heuristic algorithm in PP Dendroscope. The lowest stable ancestor (LSA) technique is used for building consensus tree in A (From: Singh et al., 2013, submitted). RESULTS (4) AB

THE INTERNATIONAL iBOL PROJECT The iBOL&CBOL are main global initiatives. The Fish-BOL, its part, has over 5400 species barcoded by Co-1 from more than 30,000 specimens what makes it unique. P. Hebert and B. Hanner are preparing a $150M grant application for Genome Canada only for Other nations’ funds in iBOL are also big in some countries and unions: USA, EU. In this year there will be held 5th world-wide international conference (November 2013, China) and many regional meeting were performed.

INTERNATIONAL PROJECT, BARCODING OF LIFE, iBOL (1) iBOL, CBOL, Fish-BOL. DataBase is species and DNA-barcodes at Co-1 gene (BOLD, ). Main Aim. The Whole Biodiversity Description. 1 million 700 are known now (without bacteria). Supposed number is 10 M, i.e. majority are still unknown.

INTERNATIONAL PROJECT, BARCODING OF LIFE, iBOL (2) Co-Chair: P. Hebert и B. Ward

AREA OF INVESTIGATION: START UP Executing Chair: Youn-Ho Lee Co-Chairs: Yuri Kartavtsev T. Shao, Shunpin He, Keiichi Matsuura, Youn- Ho Lee РАБОЧАЯ ГРУППА ПО СЕВЕРОВОСТОЧНОЙ АЗИИ North East Asian Regional Working Group

OUR OWN RESULTS ON FISH Some objects: (1) Opisthocentrus ocellatus, (2) (Ammodytidae), (3) Mioxocephalus brandtii, (4) Hemitripterus villosus (Cottidae) (Images: O. Rutenko, 4 - A. Sokolovsky). Some objects: (1) Opisthocentrus ocellatus, (2) Ammodytes hexapterus 306a (Ammodytidae), (3) Mioxocephalus brandtii, (4) Hemitripterus villosus (Cottidae) (Images: O. Rutenko, 4 - A. Sokolovsky)

SAMPLE OF DATABASE: M. brandti

FISH-BOL. RUSSIA DEVELOPMENT

THANKS FOR ATTENTION! GRANT SUPPORT: FEB RAS GRANT SUPPORT: FEB RAS 12-I-OBN-07, 12-II-СО , and KPFI

SPECIATION MODES (SM): POPULATION GENETIC VIEW ABSENCE OF QUANTITATIVE THEORY OF SPECIATION (QTS) We concluded that the speciation theory in evolutionary genetics is absent in exact scientific meaning, which expects the ability to predict future by the theory. In this case this is to predict species origin, or at least discriminate among several speciation modes on the basis of some quantitative parameters or their empirical estimates. Attempts made in this direction (Avise, Wollenberg, 1997, Templeton, 1998) do not fit the above criteria. That is why we attempted to step in the discrimination of the speciation modes on the basis of main population genetic measurements available in literature, and that may be laid in the frame of a genetic speciation concept. BASEMENT FOR THE QTS As a basis for the set of evolutionary genetic concepts we used verbal descriptions of speciation modes made by Templeton (1981). As a result the classification scheme for 7 different modes of speciation was created (Fig. 3.3). This approach leads to quite simple experimental scheme that permits: (i) to arrange further investigation of speciation in different groups of organisms, and (ii) to derive analytical relations for each speciation mode (Fig. 3.4). EMPIRICAL QTS TESTING The scheme was tested for Cyprinids (Kartavtsev et al., 2002) and explains well our own earlier data on salmons (Kartavtsev, Mamontov, 1983, Kartavtsev et al., 1983). Certainly, both the testing of the scheme presented, and its theoretic background must be further developed.

Fig SPECIATION MODES (SM): POPULATION GENETIC VIEW (From: Kartavtsev, 2011a, Marine Genomics) Fig SPECIATION MODES (SM): POPULATION GENETIC VIEW (From: Kartavtsev, 2011a, Marine Genomics)

Fig ANALITICAL DESCRIPTION OF SEVEN TYPES OF SPECIATION MODES Fig. 11. Analytic representation of seven speciation mode (From Kartavtsev, 2009 with modifications). D1–D3, divergent speciation modes; T1–T4, transformative (transilience) speciation modes. Descriptors: D, genetic distances for structural gene; D T, p T : in putative parental taxon; D S, p S : among conspecific demes; D D, p D : among subspecies or sibling species; H D,  D : mean heterozygosity/diversity in putative daughter population; H P,  P : mean heterozygosity/diversity in putative parental population; E P : divergence at regulatory genes in putative parental taxon; E D : divergence at regulatory genes in putative daughter taxon; TM+: test for modification (positive); TM–: test for modification (negative).  1 (S)  {(D T > D S )  (E D = E P )  (H D = H P )  (p T > p S )  (  D =  P )  TM - } (D1)  2 (S)  {(D T > D S )  (E D = E P )  (H D = H P )  (p T > p S )  (  D =  P )  TM - } (D2)  3 (S)  {(D T = D S )  (E D = E P )  (H D = H P )  (p T = p S )  (  D < =  P )  TM - } (D3)  4 (S)  {(D T > D S )  (E D = E P )  (H D = H P )  (p T > p S )  (  D =  P )  TM - } (T1)  5 (S)  {(D T > D S )  (E D = E P )  (H D = H P )  (p T > p S )  (  D =  P )  TM - } (T2)  6 (S)  {(D T > D S )  (E D = E P )  (H D = H P )  (p T > p S )  (  D =  P )  TM - } (T3)  7 (S)  {(D T > D S )  (E D = E P )  (H D = H P )  (p T > p S )  (  D =  P )  TM - } (T4)

Summary Algorithms of nucleotide diversity estimates and other measures of genetic divergence for the two genes Cyt-b (cytochrome b) and Co-1 (cytochrome oxidase 1) are analyzed. Based on the theory and algorithms of distance estimates on DNA sequences, as well as on the observed distance values retrieved from literature, it is recommended for realistic tree building to use a specific nucleotide substitution model from at least 56 available. Using a database of p- distances and similar measures gathered from published sources and GenBank sequences, genetic divergence of populations (1) and taxa of different rank, such as subspecies, semispecies or/and sibling species (2), species within a genus (3), species from different genera within a family (4), and species from separate families within an order (5) have been compared. Distance data for 20,731 species reveal various and increasing levels of genetic divergence of the sequences of the two genes, Cyt-b and Co-1 (cytochrome b, and cytochrome c oxidase subunit 1), in the five groups compared. Mean unweighted scores of p-distances for five groups are: Cyt-b (1) 1.38±0.30, (2) 5.10±0.91, (3) 10.31±0.93, (4) 17.86±1.36, (5) 26.36±3.88 and Co- 1 (1) 0.89±0.16, (2) 3.78±1.18, (3) 11.06±0.53, (4) 16.60±0.69, (5) 20.57±0.40. The estimates show good correspondence with other analyses. Differences in divergence between the genes themselves at the five hierarchical levels were also found. This conforms to the ample evidence showing different and nonuniform evolution rates of these and other genes and their various regions. The results of the analysis of the nucleotide divergence within species and higher taxa of animals are (1) in a good agreement with previous results and showed the stability of a general trend, and (2) suggest that a phyletic evolution in animals prevails at the molecular level, and speciation mainly corresponds to the geographic mode (type D1) that well fails in a frame of the Biological Species Concept (BSC). The prevalence of the D1 speciation mode and the BSC does not mean that other modes are absent and concepts are invalid. It is shown how we can recognize speciation modes formally with the operational genetic criteria.