KEY CONCEPT Mutations are changes in DNA that may or may not affect observable traits/characteristics.

Slides:



Advertisements
Similar presentations
What do you think of when you hear the word “mutation”?
Advertisements

Defined: any change in an organism’s DNA Where: Single genes or entire chromosomes – Some gene mutations change phenotype (physical characteristics)
SC.912.L.16.4 Explain how mutations in the DNA sequence may or may not result in phenotypic change. Explain how mutations in gametes may result in.
Chapter 12-Inheritance Patterns and Human Genetics
Chapter 8 Section 8.7: Mutations.
Defined: a change in an organism’s DNA Where: DNA or Chromosomes When: During replication, Synapses, or Crossing-Over Mutations can affect a single.
A mutation is a change in an organism’s DNA.
Mutations are changes in DNA that may or may not affect phenotype.
8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.
DNA Unit. Structure of DNA - shape is a double helix - a long polymer made of smaller units (monomers) called nucleotides.
Mutations Chapter 12.4.
Turn to your notes page after yesterday’s sheet! Read & do those questions… Quick, quick quick, 10 minutes! Happy Thursday!!! 10/27/2011.
Mutations
Genetic Mutations Increasing Genetic Diversity May 4, 2010.
Mutations. A Mutation is a change in an organism’s DNA  It can occur naturally whenever a base is incorrectly copied, especially during DNA Replication.
MUTATIONS Honors Biology Section 11.6 & Biology Section 8.7 Revised 2011.
8.7 Mutations TEKS 6E The student is expected to: 6E identify and illustrate changes in DNA and evaluate the significance of these changes.
Genes and Gene Mutations. Gene: a sequence of DNA bases that code for a product, usually a protein. Gene mutation: a change in the sequence of bases.
MUTATIONS.
8.7 Mutations A mutation is a change in an organism’s DNA. This may or may not affect phenotype.
MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.
KEY CONCEPT 8.5 Translation converts an mRNA message into a polypeptide, or protein.
Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)
8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.
Reality Science Fiction! Just silly.. 1. Some mutations affect a single gene, while others affect an entire chromosome. 2. A mutation is a change in an.
8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.  May occur in somatic cells (aren‘t passed to offspring)
Central Dogma of Molecular Biology Genetic information flows in one direction – from DNA to RNA to proteins.
MUTATIONS Mutations Defined: a change in an organism’s DNA. Many kinds of mutations can occur, especially during replication. 2 Types: 1)Gene Mutations:
8.7 Mutations A mutation is a change in an organism’s DNA. May occur during replication. May affect a single gene, or an entire chromosome May or may not.
12.4 Mutations.  What is a mutation and where can it occur? Inheritable change in genetic code 99.9 % are harmful, only 0.1% are helpful  Any change.
8.2 KEY CONCEPT DNA structure is the same in all organisms.
8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.
May occur in somatic cells (aren‘t passed to offspring)
Mutations 6/26/2018 SB2d.
Mutations.
A mutation is a change in an organism’s DNA.
A mutation is a change in an organism’s DNA.
Gene Mutations.
Mutations.
DNA Unit.
Mutations LN #23 Ms. Garcia California Content Standard Genetics
A mutation is a change in an organism’s DNA.
UNIT 5 Protein Synthesis.
A mutation is a change in an organism’s DNA.
A mutation is a change in an organism’s DNA.
A mutation is a change in an organism’s DNA.
DNA Unit.
Some mutations affect a single gene, while others affect an entire chromosome.
mutation = change in an organism’s DNA.
Mutations.
A ____________ is a change in an organism’s DNA.
Sexual reproduction creates unique combinations of genes.
A mutation is a change in an organism’s DNA.
SB2. The learner will analyze how biological traits are passed on to successive generations. d. Describe the relationships between changes in DNA and potential.
A mutation is a change in an organism’s DNA.
A mutation is a change in an organism’s DNA.
Mutations Ms MacCormack Fall 2018.
Mutations Chapter 8.7.
SC.912.L.16.4 Explain how mutations in the DNA sequence may or may not result in phenotypic change. Explain how mutations in gametes may result in.
Mutations.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
A mutation is a change in an organism’s DNA.
A mutation is a change in an organism’s DNA.
Mutations Chapter 8.7
Copyright Pearson Prentice Hall
A mutation is a change in an organism’s DNA.
A mutation is a change in an organism’s DNA.
A mutation is a change in an organism’s DNA
Presentation transcript:

KEY CONCEPT Mutations are changes in DNA that may or may not affect observable traits/characteristics.

A mutation is a change in an organism’s DNA. Some mutations affect a single gene, while others affect an entire chromosome. A mutation is a change in an organism’s DNA. Many kinds of mutations can occur, especially during replication. A point mutation substitutes one nucleotide for another. mutated base

Many kinds of mutations can occur, especially during replication. A frameshift mutation inserts or deletes a nucleotide in the DNA sequence.

Mutations may or may not affect observable traits. A mutation may cause a premature stop codon. A mutation may change protein shape or the active site. Cystic Fibrosis is caused by a deletion. The coronary artery supplies blood to the heart. A mutation exists that protects against blockages. blockage no blockage

Some gene mutations do not affect observable traits. A mutation may be silent. Many amino acids have more than one code Ex: AAG and AAA are both lysine A mutation may occur in a noncoding region. A mutation may not affect protein folding or the active site. Changed amino acid may have the same size and polarity and may not change the function much

Impact on Offspring Mutations in body cells do not affect offspring. These cells are not passed on to offspring. Mutations in sex cells are passed on and can be harmful or beneficial to offspring. Usually, offspring do not develop properly and are not able to reproduce Natural selection often removes mutant genes from a population when they are less adaptive. Rarely, a mutation results in a superior trait that is passed on and causes an increase in population.

Mutations can be caused by several factors. **Mutations can happen faster than the body is able to repair them Replication errors can cause mutations (DNA Polymerase does not detect them all). Mutagens, such as UV ray and chemicals, can cause mutations. UV light breaks the T-A bond and causes the them to bond incorrectly. This can result in cancer. Some cancer drugs use mutagenic properties to kill cancer cells.

Review Where/when do most mutations occur? What is the difference between a point mutation (1 type) and a frameshift mutation (2 types)? Contrast the results of a point mutation and a frameshift mutation Why aren’t mutations in body cells passed on to the next generation? What’s the big deal? Doesn’t the DNA have proofreading/repair mechanisms? THINK: How could a mutated gene produce a shorter protein than the normal gene?