Two sequences Multiple sequences Local Blastz (zPicture-dcode.org) ALIGNMENTCONVERVED TFBS LAGAN (mVISTA) Global TBA/Multiz (Mulan-dcode.org) Local rVISTA.

Slides:

Advertisements

Similar presentations

Pairwise Sequence Alignment Sushmita Roy BMI/CS 576 Sushmita Roy Sep 10 th, 2013 BMI/CS 576.

Advertisements

1 Aligning Multiple Genome Sequences With the Threaded Blockset Aligner Blanchette, W., Kent, W.J., Riemer, C., Elnitski, L., Smit, A.F.A., Roskin, K.M.,

Blast outputoutput. How to measure the similarity between two sequences Q: which one is a better match to the query ? Query: M A T W L Seq_A: M A T P.

1 Orthologs: Two genes, each from a different species, that descended from a single common ancestral gene Paralogs: Two or more genes, often thought of.

Whole genome alignments Genome 559: Introduction to Statistical and Computational Genomics Prof. James H. Thomas.

Sources Page & Holmes Vladimir Likic presentation: 20show.pdf

Finding regulatory modules from local alignment - Department of Computer Science & Helsinki Institute of Information Technology HIIT University of Helsinki.

Seeds for Similarity Search Presentation by: Anastasia Fedynak.

Multiple alignment June 29, 2007 Learning objectives- Review sequence alignment answer and answer questions you may have. Understand how the E value may.

CS273a Lecture 10, Aut 08, Batzoglou Multiple Sequence Alignment.

What is Alignment ? One of the oldest techniques used in computational biology The goal of alignment is to establish the degree of similarity between two.

Multiple Sequence Alignments. Lecture 12, Tuesday May 13, 2003 Reading Durbin’s book: Chapter Gusfield’s book: Chapter 14.1, 14.2, 14.5,

Sequence Comparison Intragenic - self to self. -find internal repeating units. Intergenic -compare two different sequences. Dotplot - visual alignment.

Performance Optimization of Clustal W: Parallel Clustal W, HT Clustal and MULTICLUSTAL Arunesh Mishra CMSC 838 Presentation Authors : Dmitri Mikhailov,

Defining the Regulatory Potential of Highly Conserved Vertebrate Non-Exonic Elements Rachel Harte BME230.

Computational Biology, Part 2 Sequence Comparison with Dot Matrices Robert F. Murphy Copyright  1996, All rights reserved.

Bioinformatics Genome anatomy Comparisons of some eukaryotic genomes Allignment of long genomic sequences Comparative genomics Oxford Grid Reconstruction.

Sequence comparison: Significance of similarity scores Genome 559: Introduction to Statistical and Computational Genomics Prof. James H. Thomas.

Whole genome alignments Genome 559: Introduction to Statistical and Computational Genomics Prof. James H. Thomas

Novel computational methods for large scale genome comparison PhD Director: Dr. Xavier Messeguer Departament de Llenguatges i Sistemes Informàtics Universitat.

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

Chapter 5 Multiple Sequence Alignment.

Alignment Statistics and Substitution Matrices BMI/CS 576 Colin Dewey Fall 2010.

Multiple Sequence Alignment CSC391/691 Bioinformatics Spring 2004 Fetrow/Burg/Miller (Slides by J. Burg)

Sequence Alignment.

Traceback and local alignment Prof. William Stafford Noble Department of Genome Sciences Department of Computer Science and Engineering University of Washington.

Chapter 11 Assessing Pairwise Sequence Similarity: BLAST and FASTA (Lecture follows chapter pretty closely) This lecture is designed to introduce you to.

The UCSC Genome Browser Introduction

Gapped BLAST and PSI- BLAST: a new generation of protein database search programs By Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schäffer, Jinghui.

Genome Alignment. Alignment Methods Needleman-Wunsch (global) and Smith- Waterman (local) use dynamic programming Guaranteed to find an optimal alignment.

Pairwise Sequence Alignment. The most important class of bioinformatics tools – pairwise alignment of DNA and protein seqs. alignment 1alignment 2 Seq.

Lecture 6. Pairwise Local Alignment and Database Search Csc 487/687 Computing for bioinformatics.

ANALYSIS AND VISUALIZATION OF SINGLE COPY ORTHOLOGS IN ARABIDOPSIS, LETTUCE, SUNFLOWER AND OTHER PLANT SPECIES. Alexander Kozik and Richard W. Michelmore.

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

VISTA family of computational tools for comparative genomics How can we leverage genome sequences from many species to learn about genome function?How.

Multiple Sequence Alignments Craig A. Struble, Ph.D. Department of Mathematics, Statistics, and Computer Science Marquette University.

Construction of Substitution Matrices

Bioinformatics Multiple Alignment. Overview Introduction Multiple Alignments Global multiple alignment –Introduction –Scoring –Algorithms.

Chapter 3 Computational Molecular Biology Michael Smith

Basic terms:  Similarity - measurable quantity. Similarity- applied to proteins using concept of conservative substitutions Similarity- applied to proteins.

Copyright OpenHelix. No use or reproduction without express written consent1.

Identification of Compositionally Similar Cis-element Clusters in Coordinately Regulated Genes Anil G Jegga, Ashima Gupta, Andrew T Pinski, James W Carman,

Orthology & Paralogy Alignment & Assembly Alastair Kerr Ph.D. [many slides borrowed from various sources]

Basic Local Alignment Search Tool BLAST Why Use BLAST?

Copyright OpenHelix. No use or reproduction without express written consent1.

Biocomputation: Comparative Genomics Tanya Talkar Lolly Kruse Colleen O’Rourke.

tools for synteny analysis

Construction of Substitution matrices

Doug Raiford Phage class: introduction to sequence databases.

1 MAVID: Constrained Ancestral Alignment of Multiple Sequence Author: Nicholas Bray and Lior Pachter.

Comparative Genomics I: Tools for comparative genomics

Copyright OpenHelix. No use or reproduction without express written consent1.

MicroRNA Prediction with SCFG and MFE Structure Annotation Tim Shaw, Ying Zheng, and Bram Sebastian.

Copyright OpenHelix. No use or reproduction without express written consent1.

1 Multiple Sequence Alignment(MSA). 2 Multiple Alignment Number of sequences >2 Global alignment Seek an alignment that maximizes score.

Local alignment and BLAST Usman Roshan BNFO 601. Local alignment Global alignment recursions: Local alignment recursions.

Part 4. Inferring Relationships Ch15. Computational Approaches in Comparative Genomics IDB Lab. Seoul National University Presented by Kangpyo Lee Bioinformatics:

1 Repeats!. 2 Introduction  A repeat family is a collection of repeats which appear multiple times in a genome.  Our objective is to identify all families.

Practice -- BLAST search in your own computer 1.Download data file from the course web page, or Ensemble. Save in the blast\dbs folder. 2.Start a CMD window,

Techniques for Protein Sequence Alignment and Database Searching G P S Raghava Scientist & Head Bioinformatics Centre, Institute of Microbial Technology,

Bioinformatics Shared Resource Bioinformatics : How to… Bioinformatics Shared Resource Kutbuddin Doctor, PhD.

BLAST BNFO 236 Usman Roshan. BLAST Local pairwise alignment heuristic Faster than standard pairwise alignment programs such as SSEARCH, but less sensitive.

Piecewise linear gap alignment.

Supplemental Figure-Genome alignment of TX16 and Aus0004

Local alignment and BLAST

Pairwise Sequence Alignment

Problems from last section

MULTIPLE SEQUENCE ALIGNMENT

Basic Local Alignment Search Tool

Presentation transcript:

Two sequences Multiple sequences Local Blastz (zPicture-dcode.org) ALIGNMENTCONVERVED TFBS LAGAN (mVISTA) Global TBA/Multiz (Mulan-dcode.org) Local rVISTA at at dcode.org PROMOTER SEQUENCE ALIGNMENT Promoter Sequence Alignment Daniel Rico, PhD. Daniel Rico, PhD.

Whole Genome Alignments Local aligners – Work by “stacking” pairwise alignments – High specificity – BlastZ, LastZ, TBA + MultiZ Global aligners – Need to pre-define collinear segments – Better sensitivity – AVID/MAVID, LAGAN/MLAGAN, Pecan Mixed aligners – Combine both approaches – Shuffle-LAGAN, MAUVE 2

Reference Sequence Idea – A sequence is fixed as the reference to which all other sequences are compared S1: A T G C T C S2: A G A G C S3: T T C T G S4: A T T G C A T G C S1: A T － G C － T － C S2: A －－ G A － G － C S3: － T － T C － T － G S4: A T T G C A T G C S1: A T G C T C S2: A － G A G C S1: A T G C T C S2: A － G A G C S3: － T T C T G 3

Benefit Simplicity Drawbacks Regions conserved in a subset of the species, but absent from the reference sequence, are not identified. Alignments generated with different reference sequences may be inconsistent. Inconsistent: Two positions that are aligned to each other using one reference sequence might be aligned to different positions when another reference sequence is chosen. S1: A T － G C － T － C S2: A －－ G A － G － C S3: － T － T C － T － G S4: A T T G C A T G C S1: A T G C T C S2: A G A G C S3: T T C T G S4: A T T G C A T G C 4

Blast Z : Improved pairwise alignment of Genomic Sequences Nucleotide local alignment program developed by Webb Miller's group ( BlastZ computes local alignments for sequences of any length based on the assumption that the input sequences are related and share blocks of high conservation that are separated by regions that lack homology and vary in length in the two sequences. Penalizes gaps using a large gap-opening penalty and small gap- extension penalty, to reduce the over-penalization of longer gaps Zpicture is web server for aligning 2 sequences wit BlastZ: 5

mVISTA: AVID, LAGAN and Shuffle-LAGAN 6

AVID, LAGAN AND MLAGAN ASSUME THAT ONE HAS ALREADY IDENTIFIED APPARENT ORTHOLOGOUS REGIONS BETWEEN TWO SPECIES, AND THAT THERE ARE NO GENOMIC REARRANGEMENTS 7

Copyright OpenHelix. VISTA Enhancer Browser Enhancer Browser Combines computational and experimental data

Copyright OpenHelix. VISTA Alignment display GTAGTGCCACTGAGTGTGACAGGGATGGCAAGAAAAGCATTAAGTTCCAAGGGGAAAGAA >>>>>>>>> | || ||| ||| |||| |||||||||| | || || |||| | |||||||| <<<<<<<<< GAGATGTCACCAAGTA-AACAGAGATGGCAAGAGGACCAATAGGTTCTAGTGGGAAAGAC “sliding window” to measure sequence conservation (default window size 100bp) Graphical presentation of sequence conservation as “peaks-and-valley” curve >70% identity base sequence coordinates % identity

(A) Standard stacked-pairwise visualization (smooth graph) of Mulan alignments of NOS-2 gene promoter. The human sequence (from -10 kb to +1 kb) was selected as the reference species. Repeats were masked in all species with RepeatMasker (Mulan settings); green regions in the base sequence indicate the human repeats. The graphical representations of the other sequences are displayed according to their similarity to the base sequence: the closer they are to human, the higher is the conservation (top sequences are less conserved). Parameters selected for detection of evolutionarily conserved regions (ECR) were 90 bp minimum length and minimum similarity of 65% (50% bottom cut-off). Red indicates regions that are upstream from the transcription start site; pink regions are downstream from it. Two conserved motifs in rodent NOS-2 promoters indicate the presence of distal and fragmented sequences that are very similar to the unique enhancer region conferring NF-κB regulation in human NOS-2. (B) A schematic representation of the hypothetical translocation of these sequences in human and rodents; double head arrows indicate the positional translocation. Rico et al. BMC Genomics :271 doi: / ECRs: Evolutionary Conserved Regions with Mulan Promoter Sequence Alignment

Two sequences Multiple sequences Local Blastz (zPicture-dcode.org) ALIGNMENTCONVERVED TFBS LAGAN (mVISTA) Global TBA/Multiz (Mulan-dcode.org) Local rVISTA at at dcode.org PROMOTER SEQUENCE ALIGNMENT Promoter Sequence Alignment Daniel Rico, PhD. Daniel Rico, PhD.