Dot Plot. Goal We will take two nucleotide base strings and look for common patterns – stretches where the bases match. GAATTCATACCAGATCACCGAAAACTGTCCTCCAA.

Slides:

Advertisements

Similar presentations

Spreadsheet Vocabulary

Advertisements

Spreadsheet Vocabulary Split the screen so you can see the words AND the crossword puzzle AND the quiz at the same time.

2 pt 3 pt 4 pt 5pt 1 pt 2 pt 3 pt 4 pt 5 pt 1 pt 2pt 3 pt 4pt 5 pt 1pt 2pt 3 pt 4 pt 5 pt 1 pt 2 pt 3 pt 4pt 5 pt 1pt E XCEL.

Spreadsheet Software lesson 14. This lesson includes the following sections: Spreadsheet Programs and Their Uses The Spreadsheet's Interface Entering.

Intermediate Formulas & Functions Instructor: Rachel Baltus.

Click the mouse to continue. Relative references Absolute referencesMixed references.

E ngineering College of San Jose State University Engr.10 1 JKA & KY.

Enter formulas Use cell references Cell references identify individual cells or cell ranges in columns and rows. Cell references tell Excel where to look.

Microsoft Excel. What is Microsoft Excel? Spreadsheet program that allows users to organize data, complete calculations, make decisions, and graph data.

Objectives 1.Identify the functions of a spreadsheet 2.Identify how spreadsheets can be used. 3.Explain the difference in columns and rows. 4.Locate specific.

String and Lists Dr. Benito Mendoza. 2 Outline What is a string String operations Traversing strings String slices What is a list Traversing a list List.

Text Mining & Basic Calculations Supplemental Resources on Class Website.

Physical Mapping II + Perl CIS 667 March 2, 2004.

Fall 2004COMP 3351 Languages. Fall 2004COMP 3352 A language is a set of strings String: A sequence of letters/symbols Examples: “cat”, “dog”, “house”,

REVIEW Excel Excel Absolute vs. Relative Address.

Relative and absolute addressing. Cell Referencing Cell referencing is the method by which you refer to a cell or series of cells in a formula Cell referencing.

Using Excel To help with data. Excel is a spreadsheet program that can interface with Word, or PowerPoint A spreadsheet program has cells (little blocks)

FIRST COURSE Excel Tutorial 1 Getting Started with Excel.

Microsoft Office 2007 Excel Presented By: Steph Flatau.

Importing Data Text Data Parsing Scrubbing Data June 21, 2012.

Pairwise Alignment, Part I Constructing the Values and Directions Tables from 2 related DNA (or Protein) Sequences.

VOCAB REVIEW. letters at the top of the worksheet window that identify the vertical information in a worksheet column headings Click for the answer Next.

KASBO Beginning Excel.  Customizing Excel  Copying and Moving Data  Entering Data  Formatting Data  Selecting and Navigating Data  Filtering, Sorting,

GIS 1 GIS Lecture 4 Geodatabases. GIS 2 Outline Administrative Data Example Data Tables Data Joins Common Datasets Spatial Joins ArcCatalog Geodatabases.

Lists in Python.

2/25: Using Microsoft Excel

Excel Spreadsheet basics. Excel Sheets and Books  Spreadsheet: tool to analyze, chart and manage data for personal, business and financial use Worksheet:

CHAPTER 13 Creating a Workbook Part 1. Learning Objectives Understand spreadsheets and Excel Enter data in cells Edit cell content Work with columns and.

Active Cell Name Box Title Bar Formula Bar ColumnsMenu Bar Formatting Toolbar Standard Toolbar Rows Cell Fill Handle.

1 ADVANCED MICROSOFT EXCEL Lesson 9 Applying Advanced Worksheets and Charts Options.

Creating Charts for the Agency Budget Creating Budget Charts, Slide 1Copyright © 2004, Jim Schwab, University of Texas at Austin.

 Agenda: 4/24/13 o External Data o Discuss data manipulation tools and functions o Discuss data import and linking in Excel o Sorting Data o Date and.

1 Languages. 2 A language is a set of strings String: A sequence of letters Examples: “cat”, “dog”, “house”, … Defined over an alphabet:

GIS 1 GIS Lecture 4 Geodatabases Copyright – Kristen S. Kurland, Carnegie Mellon University.

10/3: Using Microsoft Excel

The introduction of Microsoft Excel. Spreadsheet Basic.

1. First of all we opened up a spreadsheet and started adding the data. 2. To work out the total cost for platinum, you times cell b5*c5 3. To calculate.

Copying and Pasting Formulas and Functions Copying and Pasting Formulas and Functions, Slide 1Copyright © 2004, Jim Schwab, University of Texas at Austin.

Microsoft Excel P.6 Computer Studies Chapter 1 – Introduction of Microsoft Excel What is Microsoft Excel? Microsoft Excel is a software for.

IFS Intro to Data Management Chapter 5 Getting More Than Simple Columns.

Jeopardy Template By Jeanne Whitmore & Brooke Blair.

Absolute cell reference

ACIS Introduction to Data Analytics & Business Intelligence Text Mining Data Cleaning.

Text Mining Supplemental Resources on Class Website.

Spreadsheets COE 201- Computer Proficiency. Basic Interface Excel Book = Word Document Every book can contain up to 255 different sheets.

  Relative Cell Reference : automatically change when copied  Ex. Write a formula in C6: A6 + B6 = C6  Excel will use the above cell to copy for formattin.

Vocabulary Basic Spreadsheet Formulas Copyright © Texas Education Agency, All rights reserved.

Microsoft Excel Prepared by the Academic Faculty Members of IT.

Excel: Fill and Fill Series Computer Information Technology Section 6-10 Some text and examples used with permission from: Note:

String and Lists Dr. José M. Reyes Álamo. 2 Outline What is a string String operations Traversing strings String slices What is a list Traversing a list.

Click once to reveal the definition. Think of the answer. Then click to see if you were correct. Spreadsheet / Workbook A grid of rows and columns containing.

A lesson approach. 2 Insert and delete sheets and cells. 1 Copy, cut, and paste cell contents. 2 Use AutoComplete and Pick From Drop-down List. 3 Use.

Creating a Workbook Part 1

String and Lists Dr. José M. Reyes Álamo.

Chapter 6 Modifying Cell Styles

Excel Adrressing and Linking

Creating and Formatting Tables

Using Excel to Graph Data

Sequence Alignment 11/24/2018.

The Mid Function.

Objective: Today we will investigate the ‘magic’ in magic squares.

Point Question Point Question Point Question Point Question

String and Lists Dr. José M. Reyes Álamo.

Using Excel to Graph Data

HOW TO COPY AND PASTE THE SNAP CUBES.

HOW TO COPY AND PASTE THE SNAP CUBES.

HOW TO COPY AND PASTE THE SNAP CUBES.

HOW TO COPY AND PASTE THE SNAP CUBES.

When you first open up in notepad, go to Edit and click Select All

Presentation transcript:

Dot Plot

Goal We will take two nucleotide base strings and look for common patterns – stretches where the bases match. GAATTCATACCAGATCACCGAAAACTGTCCTCCAA ATGTGTCCCCCTCACACTCCCAAAT TCGCGGGCTTCTGCTCTTAGACCACTCTACCCTAT TCCCCACACTCACCGGAGCCAAAGC

Start by entering the two sequences in question in Excel

Use the LEN Function to determine the length of the string

Set up a grid – mine was 60-by-60 since the lengths were 60

Enter the length of match one is seeking – start with 1

Enter the formula to look for matches

Anatomy of the formula (Part 1) =IF(MID($B$1,E$3,$B$4)=MID($B$2,$D4,$B$4),1,0) Recall MID takes a string $B$1 is the first base sequence and $B$2 is the second base sequence Then MID takes a part of the string beginning at the “second argument”

Anatomy of the formula (Part 2) =IF(MID($B$1,E$3,$B$4)=MID($B$2,$D4,$B$4),1,0) The starting point varies. E$3 stays in the third row as the formula is copied and uses the various numbers 1 through 60 set up in row 3. $D4 stays in column D and uses the various numbers 1 through 60 set up in column D.

Anatomy of the formula (Part 3) The third argument is the length of the match we seek. They are both the same length. If the two “substrings” (base mini sequences) match, output a 1, otherwise a zero. Then copy the formula throughout the grid.

With formula copied

Next add some conditional formatting rules

Result of Conditional Formatting

We are we looking for? In dot plots, one looks for dots (for us colored cells) along diagonals. A “long” diagonal means that the mini base sequences within the longer sequence match.

Change the length to eliminate some of the “noise”

Increasing the length of the substring match

Question What is the longest match between these two sequences?

Problem We are looking for diagonal matches; however, increasing the length of the match only allows only one of the two diagonal types to survive.

New Sheet: Enter one string and also make column of descending numbers

Enter formula that takes one letter at designated position

Use the concatenate formula to create the reversed string

Use Copy/Paste Special/Values to enter reversed string

Repeat the analysis looking for matches between one original and one reversed string

Question What is the longest match between these one of the original sequences and one of the reversed sequences?