Molecular Identification of Pathogens in Nursery Crops

Slides:

Advertisements

Similar presentations

Yaron Fireizen, Vinay Rao, Lacy Loos, Nathan Butler, Dr. Julie Anderson, Dr. Evan Weiher ▪ Biology Department ▪ University of Wisconsin-Eau Claire From.

Advertisements

ISSAG Viterbo - 22 / 26 August 2005 CONTRIBUTION TO FINE MAPPING OF OL-2 LOCUS IN TOMATO MINOIA SILVIA Department of Agro-forestry and Environmental Biology.

Identification of molecular markers for selection of supermale (YY) asparagus plants Gebler et al

DNA BARCODING CHILLIES BIO-NERDS : Say Wah Yugraj Singh Tanja Obradovic Jenny Pham Lovita Bharossa Buai Chuol Diana Corzo.

Amplifying DNA. The Power of PCR View the animation at

PCR amplification of ovine somatotropin gene and its partial characterization Moazzam Ali & Dr. Waheed Akhtar.

2. Objective To develop early, sensitive and specific detection methods for P. horiana 3. Materials and methods Two different strategies were explored:

Development and Application of SNP markers in Genome of shrimp (Fenneropenaeus chinensis) Jianyong Zhang Marine Biology.

(a) (b) (c) (d) (e) (f) (g) Figure S1.. Figure S1. Comparison of OsPCR1-6 and GW2 transcript levels in the grains of developing gw2 and wild-type isogenic.

PCR assay of intragenic mutation lesions induced by monoenergetic fission neutrons and gamma rays in Drosophila Part I: Gamma rays Nanette Brand 1 Nonhlanhla.

Evaluation of Three Extraction Methods for DNA Quantification and PCR Detection in Cocoa-Derived Products. Assessment of Genetic Diversity of the Main.

Phylogeography of Leucetta chagosensis (Porifera, Calcarea) Christoph Flucke, Jens Kurz, Rasmus Liedigk, Zdenka Valenzova Fig.4: RAxML Phylogram Fig.5:

Northern Star Coral (Astrangia poculata) Populations from the New Jersey Coast. Abstract- This project investigated the distribution and molecular evolution.

Comparative Evaluation of Three Extraction Methods for DNA Quantification and PCR Detection in Cocoa and Cocoa-Derived Products Lam Thi Viet Ha a, Lore.

TILLING, a non-GMO approach to engineer genetic variation for disease resistance © copyright BenchBio Source: Seattle TILLING project Manash CHATTERJEE.

A New Record of Pseudeurotium bakeri (KNU14-21) from Crop Field Soil in Korea Mahesh Adhikari, Sang Woo Kim, Hyun Seung Kim, Young Hyum Um and Youn Su.

Genetic diversity of Pyrenophora tritici-repentis in Algeria as revealed by amplified fragment length polymorphism (AFLP) analysis ( 1)Ecole Nationale.

Detecting DNA with DNA probes arrays. DNA sequences can be detected by DNA probes and arrays (= collection of microscopic DNA spots attached to a solid.

Something to Smile About: DNA Barcoding of St. John’s Wort Herbal Supplements Authors: Justin Rubino, Gus Moody Mentor: Vanaja Zacharopoulos, PhD Friends.

DNA Profiling Using PCR Sara Small, Sarah Petroni, Annelise Yackow.

Assay I HLA-DQ Alpha (A1) Haplotype. Purpose To determine which one of several known alleles is present at the HLA DQ α locus on each of an individual’s.

Molecular Tools for Detection of Plant Pathogenic Fungi ByMAZIN.S.SELMAN.

Clinical Laboratory Analysis of Immunoglobulin Heavy Chain Variable Region Genes for Chronic Lymphocytic Leukemia Prognosis Philippe Szankasi, David.

Copyright © 2007 American Medical Association. All rights reserved.

Searching for the Genes that Control Seed Development

2470 bp 1891 bp WT bp 2314 bp A B Fig. S1. Verification with PCR amplification of the.

ABSTRACT MATERIALS AND METHODS DISCUSSION BACKGROUND REFERENCES

Supplemental Figure 1 A) B) C)

Supplemental Figure 2. (A) AtplaIVA-1 and AtplaIVA-2 null transcription lines for AtPLAIVA mRNA. RNAs from the relevant wild type Col were isolated.

Identification of nifH and nodC genes from Rhizobium aegyptiacum

Department of Microbiology

Using Taq-Man based real time PCR to detect pathogen caused plant disease Jingwen Song Environment and Plant biology.

New host records for Verticillium tricorpus, Corynespora cassiicola, Aphelenchoides fragariae and Helicotylenchus dihystera, associated with dieback and.

DNA analysis on patients with STS deficiency

Fig. S Fig. S2 Cre-mediated recombination in vivo. G2 mice displaying high levels of GFP were crossed.

BIOTECHNOLOGY BIOTECHNOLOGY: Use of living systems and organisms to develop or make useful products GENETIC ENGINEERING: Process of manipulating genes.

Small RNA Sample Preparation

Rafael Marques da Silva, DDS, Dominique A. Caugant, PhD, Emenike R. K

Consequences of T‐DNA insertion on SWP expression in swp mutant.

Jonathan A. Schumacher, Stephen D. Jenson, Kojo S. J

Yanggu Shi, Sharon F. Terry, Patrick F. Terry, Lionel G

Daniel Chi-Hong Lin, Alan D Grossman Cell

Comparison of the banding patterns from randomly amplified polymorphic DNA PCR assays of sequential B pseudomallei isolates from each of the cases. Comparison.

PCR-RFLP detection and species identification of fungal pathogens in patients with febrile neutropenia M. Dendis, R. Horváth, J. Michálek, F. Růžička,

A Novel Alu-Like Element Rearranged in the Dystrophin Gene Causes a Splicing Mutation in a Family with X-Linked Dilated Cardiomyopathy Alessandra Ferlini,

Silencing in Yeast rDNA Chromatin

Rotation review Gaurav Moghe Genetics Program

Complete Cure of Persistent Virus Infections by Antiviral siRNAs

Genetic characterisation of Helicobacter pylori isolates from an Argentinean adult population based on cag pathogenicity island right-end motifs, lspA-glmM.

Clinical Laboratory Analysis of Immunoglobulin Heavy Chain Variable Region Genes for Chronic Lymphocytic Leukemia Prognosis Philippe Szankasi, David.

Size Polymorphisms in the Human Ultrahigh Sulfur Hair Keratin-Associated Protein 4, KAP4, Gene Family Naoyuki Kariya, Yutaka Shimomura, Masaaki Ito

Osteopontin Gene is Expressed in the Dermal Papilla of Pelage Follicles in a Hair- Cycle-Dependent Manner Tian Yang, Pamela J. Jensen, Robert M. Lavker

Development of a novel PCR assay for the identification of the black yeast, Exophiala (Wangiella) dermatitidis from adult patients with cystic fibrosis.

Basic Local Alignment Search Tool (BLAST)

Structure of the GM2A Gene: Identification of an Exon 2 Nonsense Mutation and a Naturally Occurring Transcript with an In-Frame Deletion of Exon 2 Biao.

Rapid identification of efficient target cleavage sites using a hammerhead ribozyme library in an iterative manner Wei-Hua Pan, Ping Xin, Vuong Bui,

A Homozygous Nonsense Mutation in Type XVII Collagen Gene (COL17A1) Uncovers an Alternatively Spliced mRNA Accounting for an Unusually Mild Form of Non-Herlitz.

Volume 4, Issue 3, Pages (May 2011)

Comparison of one-tube multiplex PCR, automated ribotyping and intergenic spacer (ITS) sequencing for rapid identification of Acinetobacter baumannii

Cloning of a novel gene in the human kidney homologous to rat munc13s: Its potential role in diabetic nephropathy Yong Song, Menachem Ailenberg, Mel.

K. S. Ko, T. Kuwahara, L. Haehwa, Y. -J. Yoon, B. -J. Kim, K. -H

Usher Syndrome Type III: Revised Genomic Structure of the USH3 Gene and Identification of Novel Mutations Randall R. Fields, Guimei Zhou, Dali Huang,

PCR amplification of the ORF encoding the cytosolic p36 protein of M

Anthony M. Raizis, Martin M. Ferguson, David T. Nicholls, Derek W

Additional file 3 >HWI-EAS344:7:70:153:1969#0/1 Length = 75

Expression of multiple forms of MEL1 gene products.

Representative results of nested PCR assays for direct detection of “T

Mutation of the Ca2+ Channel β Subunit Gene Cchb4 Is Associated with Ataxia and Seizures in the Lethargic (lh) Mouse Daniel L Burgess, Julie M Jones,

Figure Genetic characterization of the novel GYG1 gene mutation (A) GYG1_cDNA sequence and position of primers used. Genetic characterization of the novel.

Fang Wang, Yunfeng Wang, Jie Ding, Jiyun Yang Kidney International

Presentation transcript:

Molecular Identification of Pathogens in Nursery Crops Ainong Shi Tennessee State University

Lilac Leaf Blight What pathogen causes this disease? How to analyze and identify it by molecular approaches?

Powdery Mildew Diseases Dogwood Lilac Crape myrtle Are they caused by same pathogen? How to analyze and identify them by molecular approaches?

Lilac leaf blight for example 1 How to identify a pathogen by molecular approach? Lilac leaf blight for example 1

Molecular Identification of Pathogen ITS universal primer analysis Specific primer analysis

ITS (Internal Transcribed Spacer) (primer) ITS1 18S rDNA 5.8S rDNA 28S rDNA ITS1 ITS2 ITS4 (primer) ITS region of rDNA has been widely used in identifying pathogens for fungal diseases in plants. Thousands of sequences of ITS regions from fungi have been published in GenBank. Universal primer pairs can amplify ITS region for all fungi.

PCR Product Sequencing ITS Universal Primer Analysis A four-step procedure DNA Extraction PCR Amplification PCR Product Sequencing Similarity Analysis

DNA Extraction Genomic DNA was extracted by use of the DNeasy Plant Mini Kit from Alternaria medium (mycelia and conidia) or directly from the lilac leaves of Alternaria leaf blight.

PCR Amplification ITS universal primers: ITS1: tccgtaggtgaacctgcgg * ITS1/ITS4 ITS universal primers: ITS1: tccgtaggtgaacctgcgg * IST4: tcctccgcttattgatatgc The primer pair ITS1/ITS4 produces a 570 bp fragment. 570 bp * White, T. J., T. Bruns, S. Lee, and J. W. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp. 315-322 In: PCR Protocols: A Guide to Methods and Applications.

PCR Product Sequence TCCGTAGGTGAACCTGCGGAGGGATCATTACACAAATATGAAGGCGGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCCTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA The sequence above amplified from the primer pair ITS1/ITS4. Primer Sequence (5’  3’) reversal sequence ITS1 TCCGTAGGTGAACCTGCGG IST4 tcctccgcttattgatatgc GCATATCAATAAGCGGAGGA

Similarity Analysis Query – from our data BLAST Search Query: 1 tccgtaggtgaacctgcggagggatcattacacaaatatgaaggcgggctggaacctctc 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 25 tccgtaggtgaacctgcggagggatcattacacaaatatgaaggcgggctggaacctctc 84 Query: 61 ggggttacagccttgctgaattattcacccttgtcttttgcgtacttcttgtttccttgg 120 Sbjct: 85 ggggttacagccttgctgaattattcacccttgtcttttgcgtacttcttgtttccttgg 144 …………………………………………………………………………………………………………………………………………………………… Query: 541 ctgaacttaagcatatcaataagcggagga 570 |||||||||||||||||||||||||||||| Sbjct: 565 ctgaacttaagcatatcaataagcggagga 594 Query – from our data Sbject – Alternaria in GenBank 570/570 (100%) identities Analysis indicates the sequence from our data belongs to ITS region of Alternaria.

Specific Primer Analysis Develop specific primers for Alternaria genus. Develop specific primers for A. alternata.

The sequence size from Al-f1 to Al-r1 is 370 bp. Primer design for ITS region of Alternaria TCCGTAGGTGAACCTGCGGAGGGATCATTACACAAATATGAAGGCGGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCCTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA Primer Sequence (5’  3’) Reversal sequence Al-f1 cccaccactaggacaaaca Al-r1 gcttaatggatgctagacct aggtctagcatccattaagc The sequence size from Al-f1 to Al-r1 is 370 bp.

Specific primer for Alternaria genus of ITS region The size of band is 370 bp. The band showed in all tested Alternaria samples. Sequence data from the PCR amplified from the specific primer pair Al-f1/Al-r1 is identical to that in ITS region of Alternaria. 370 bp The results indicated one kind of Alternaria was the pathogen.

Specific primers for Alternaria alternata (1) Primer pair GenBank Accession Gene name Sequence results Lane above aa-endo-f1 aa-endo-r1 AY629233 A. alternata endopolygalacturonase gene 100% (408/408) 1 to 4 aa-gp-f1 aa-gp-r1 AF282319 A. alternata mixed-linked glucanase precursor 99% (659/664) 5 to 8

Specific primers for Alternaria alternata (2) Primer pair GenBank Accession Gene name Sequence results Lane below aa-hsp-f1 aa-hsp-r1 AAU87808 A. alternata hsp70 mRNA 100% (237/237) 1 & 2 aa-his-f1 aa-his-r1 AF404640 A. alternata histone gene 100% (356/356) 3 & 4 1 2 3 4 M 1500 bp 1000 bp 600 bp 300 bp 100 bp

Alternaria A. alternata Alternaria alternata is one pathogen in Conclusion for example 1 Alternaria alternata is one pathogen in lilac leaf blight disease. Specific primer pairs: Alternaria Al-f1/Al-r1 aa-gp-f1/aa-gp-r1 aa-hsp-f1/aa-hsp-r1 aa-hsp-f1/aa-hsp-r2 aa-his-f1/aa-his-r1 A. alternata

Powdery Mildew Diseases Example two Powdery Mildew Diseases Dogwood Lilac Crape myrtle Are they caused by same pathogen? How to analyze and identify them by molecular approaches?

Molecular Identification Approaches ITS universal primer analysis Sequence analysis Specific primer analysis

ITS universal primer analysis Primer pair: ITS1/ITS4 M 1 2 3 -------------------------------------------------------------- Disease Band size Lane ---------------------------------------------------- Crape myrtle powdery mildew 666bp 1 Lilac powdery mildew 645bp 2 Dogwood powdery mildew 642bp 3 -----------------------------------------------------------------------------

Sequence Analysis Disease Primer pair Sequence length CG% Pathogen Dogwood powdery mildew ITS1/ITS4 642 bp 54.05 Erysiphe pulchra Lilac powdery mildew 645 bp 54.42 Microsphaera syringae-japonicae Crape myrtle powdery mildew 666 bp 51.05 Uncinuliella australiana

Specific Primer Analysis I. Erysiphe pulchra of dogwood powdery mildew M 1 2 3 4 5 6 7 8 9 M Lane 1, 4, 7 are Microsphaera syringae-japonicae Lane 2, 5, 8 are Erysiphe pulchra Lane 3, 6, 9 are Uncinuliella australiana Lane M are 100 bp ladder

Specific Primer Analysis II Uncinuliella australiana of powdery mildew in crape myrtle M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 M The bands only for U. australiana (lane 2, 6, 10, and 14) in four DNA groups: Lagerstroemia indica, (2) Uncinuliella australiana, (3) Erysiphe Pulchra, and (4) Microsphaera syringae-japonicae. Lane M are 100 bp ladder.

Specific Primer Analysis III. Microsphaera syringae-japonicae of lilac powdery mildew 1 2 3 M The band showed only for Microsphaera syringae-japonicae (lane 2) in three materials: 1. Erysiphe pulchra, 2. Microsphaera syringae-japonicae , and 3. Uncinuliella australiana. Lane M are 100 bp ladder

Eight molecular markers (specific primer pairs) Summary for example 2 Eight molecular markers (specific primer pairs) Pathogen Primer pairs A B C D E F G H Erysiphe pulchra 1 Uncinuliella australiana Microsphaera syringae-japonicae Primer pairs: D=ua-f1/ua-r3 E=ua-f1/ua-r4 F=ua-f3/ua-r3 G=ua-f3/ua-r4 A=EP-f6/EP-r3 B=EP-f6/EP-r4 C=EP-f6/EP-r5 H=msj-f2/msj-r1

Other diseases

Lilac Leaf Spot Pseudocercospora bairamifera is one pathogen in lilac leaf spot.

Identification of Botryosphaeria dothidea pathogen of leaf blight disease in dogwood (Cornus florida)

Oak Powdery Mildew

Maple Powdery Mildew

Molecular Detection of Pathogens DNA Extraction Specific Primer Design PCR Amplification Primer Test PCR Product Sequencing Sequence to Verify Similarity Analysis Pathogen Detection

Face to plant diseases How can we solve them? This is our JOB!

ACKNOWLEDGEMENTS Tennessee State University: Dr. Margaret Mmbaga, Dr. Sandra Reed, Dr. Nick Gawel, Dr. Roger Sauve, Dr. Suping Zhou, Dr. Emmanuel Nnodu, Dr. Frank Mrema, and Dr. Mario Keri.

Thank you! Thank all of you!