MicroRNA Pathways In C. elegans Development University of Massachusetts Medical School RNA Therapeutics Institute (RTI) MicroRNA Pathways In C. elegans Development Developmental Robustness

Regulation of Gene Expression by Animal MicroRNAs Invertebrates: ~150 microRNA genes Vertebrates: ~1000 microRNA genes microRNA gene Inhibition of protein production from mRNA targets Pri-microRNA GW Effectors AGO An Modulators NHL AGO AGO miRNP Pre-microRNA

How Did/Do MicroRNAs Evolve? Hsa-mir-100 AACCCGUAGAUCCGAACUUGUG Cel-mir-52 CACCCGUACAUAUGUUUCCGUGCU UGAGGUAGUAGGUUGUAUAGUU UGAGGUAGUAGGUUGUGUGGUU UGAGGUAGUAGGUUGUAUGGUU AGAGGUAGUAGGUUGCAUAGU- UGAGGUAGGAGGUUGUAUAGU- UGAGGUAGUAGAUUGUAUAGUU UGAGGUAGUAGUUUGUACAGU- UGAGGUAGUAGUUUGUGCUGU- Human let-7-Family UGAGGUAGGCUCA-GUAGAUGC UGAGGUAGUAUGUAAUAUUGUA UGAGGUAGGUGCGAGAAAUGA- Worm let-7-Family One Pan-Eumetazoan family 1 lancelet human fly beetle roundworm sea anenome mir-100 let-7 mir-125 > 35 novel Pan-Bilaterian families lancelet human fly beetle roundworm sea anenome mir-100 let-7 mir-125 MicroRNAs are Endogenous RNAi Agents lancelet human fly beetle roundworm sea anenome ~150 ~800 RNAi Eumetazoa Animals sponge ~10 >100 Plants weed ~10 Fungi mould

Evolutionary fluidity of target gene sets Explicitly-Homologous Worm Fly Human Chen and rajewsky CSHS 2006 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU cel-miR-1 UGGAAUGUAAAGAAGUAUGUA dme-miR-1 UGGAAUGUAAAGAAGUAUGGAG Chen and Rajewsky CSHS 2006

Evolution of MicroRNA-Target Interactions Explicitly-Homologous Functionally-Analogous HBL-1 differentiation let-60/Ras LIN-41 C. elegans hypodermal lineages LIN-28 let-7 let-7 human cells normal Hmga2 tumor Mayr, Hemann and Bartel, 2007

Functions of microRNA genes in C. elegans lin-4 and let- 7 control developmental timing (1993, 1999). ••••• Single gene visible phenotypes ••••• U.S. National Library of Medicine National Institutes of Health PubMed Search:All DatabasesPubMedProteinNucleotideGSSESTStructureGenomeBioSampleBioSystemsBooksCancerChromosomesConserved DomainsdbGaPdbVar3D DomainsEpigenomicsGeneGenome ProjectGENSATGEO ProfilesGEO DataSetsHomoloGeneJournalsMeSHNCBI Web SiteNLM CatalogOMIAOMIMPeptidomePMCPopSetProbeProtein ClustersPubChem BioAssayPubChem CompoundPubChem SubstanceSNPSRATaxonomyToolKitToolKitAllUniGeneUniSTS SearchClear Limits Advanced search Help RSS SettingsSearch: Number of items displayed:510152050100 Feed name: Create RSS var d = document.getElementById('search_term'); if (d) {d.focus();} Abstract Display Settings: FormatSummary Summary (text) MEDLINE Abstract (text) XML PMID List Apply Send to: jQuery(document).ready( function () { jQuery("#send_to_menu input[type='radio']").click( function () { var selectedValue = jQuery(this).val().toLowerCase(); var selectedDiv = jQuery("#send_to_menu div." + selectedValue); if(selectedDiv.is(":hidden")){ jQuery("#send_to_menu div.submenu:visible").slideUp(); selectedDiv.slideDown(); } }); }); jQuery("#sendto").bind("ncbipopperclose", function(){ jQuery("#send_to_menu div.submenu:visible").css("display","none"); jQuery("#send_to_menu input[type='radio']:checked").attr("checked",false); }); Choose DestinationFile Clipboard Collections E-mail Order FormatSummary (text)Abstract (text)MEDLINEXMLPMID List 1 selected item: 20579881 Create File FormatSummarySummary (text)AbstractAbstract (text)MEDLINEXMLPMID ListMeSH and Other Data Additional text Add to Clipboard E-mail"SPAM" filtering software notice Add to Collections Order articles Curr Biol. 2010 Jul 27;20(14):1321-5. Epub 2010 Jun 24. Brenner JL, Jasiewicz KL, Fahley AF, Kemp BJ, Abbott AL. Loss of individual microRNAs causes mutant phenotypes in sensitized genetic backgrounds in C. elegans. Department of Biological Sciences, Marquette University, Milwaukee, WI 53201, USA. Comment in: Curr Biol. 2010 Jul 27;20(14):R598-600. MicroRNAs (miRNAs) are small, noncoding RNAs that regulate the translation and/or stability of their mRNA targets. Previous work showed that for most miRNA genes of C. elegans, single-gene knockouts did not result in detectable mutant phenotypes. This may be due, in part, to functional redundancy between miRNAs. However, in most cases, worms carrying deletions of all members of a miRNA family do not display strong mutant phenotypes. They may function together with unrelated miRNAs or with non-miRNA genes in regulatory networks, possibly to ensure the robustness of developmental mechanisms. To test this, we examined worms lacking individual miRNAs in genetically sensitized backgrounds. These include genetic backgrounds with reduced processing and activity of all miRNAs or with reduced activity of a wide array of regulatory pathways. With these two approaches, we identified mutant phenotypes for 25 out of 31 miRNAs included in this analysis. Our findings describe biological roles for individual miRNAs and suggest that the use of sensitized genetic backgrounds provides an efficient approach for miRNA functional analysis. Curr Biol. 2010 February 23; 20(4): 367–373. PMCID: PMC2844791 Published online 2010 January 21. doi: 10.1016/j.cub.2009.12.051. HHMIMSID: HHMIMS185696 Copyright notice and Disclaimer Many families of Caenorhabditis elegans microRNAs are not essential for development or viability Howard Hughes Medical Institute, Department of Biology, MIT, 77 Massachusetts Avenue, Cambridge, MA 02139, USA Ezequiel Alvarez-Saavedra and H. Robert Horvitz Corresponding author. Email: horvitz@mit.edu; FAX (617) 253-8126 The publisher's final edited version of this article is available at Curr Biol See other articles in PMC that cite the published article.  Other Sections▼ Publisher's Disclaimer Summary Results and Discussion Experimental Procedures Supplementary Material References MicroRNAs (miRNAs) are approximately 23 nt regulatory RNAs that posttranscriptionally inhibit the functions of protein-coding mRNAs. We previously found that most C. elegans miRNAs are individually not essential for development or viability and proposed that paralogous miRNAs might often function redundantly 1. To test this hypothesis, we generated mutant C. elegans strains that each lack multiple or all members of one of 15 miRNA families

C. elegans “Heterochronic” Mutants Wild type lin-4(e912) (Chalfie et al, 1980) Here’s what it looks like (picture) Look closer….. What’s wrong with it Compare it to normal C. elegans (the “wild type”)

Retarded Development of lin-4 mutants Wild Type

Adult Alae Formation at L4 Molt LIN-14 over-expression L4 Molt L3 Molt lin-4 lin-14 3’ UTR Deletion

Utterly Robust Cell Fate Specification and Execution lin-4 and let-7 microRNAs control cell fate progression Embryo 1 lin-14 lin-4 2 hbl-1 Larval stages 7-Fam 3 let-7 lin-41 4 lin-14 ..C ACCAA C.. UCACA CUCAGGGA lin-4 AGUGU GAGUCCCU G A A C ACUC hbl-1 ..A CUUGU U.. AACUA CC GCUACCUUA UUGAU GG UGAUGGAGU mir-84 AUGUU A lin-41 ...U AUU U.. UUAUACAACC CUGCCUC GAUAUGUUGG GAUGGAG let-7 UU AU U Adult Adult

Genetics of microRNA genes in C. elegans lin-4 and let- 7 control developmental timing (1993, 1999). ••••• Single gene visible phenotypes ••••• Lucky! Most Caenorhabditis elegans microRNAs are individually not essential for development or viability. Miska, Abbott, Alvarez-Saavedra …Bartel, Ambros, Horvitz. PLoS Genet. (2007) A drag… No New Phenotypes The let-7 MicroRNA family … mir-48, mir-84, and mir-241 function together to regulate developmental timing in C. elegans. Abbott et al…Bartel, Horvitz, Ambros. Dev. Cell. (2005) Redundancy within a microRNA family Many families of Caenorhabditis elegans microRNAs are not essential for development or viability Ezequiel Alvarez-Saavedra and H. Robert Horvitz Curr Biol. 2010 3 of 15 families are essential The microRNA miR-1 regulates a MEF-2-dependent retrograde signal at neuromuscular junctions. Simon et al…Ruvkun, Kaplan, Kim. Cell. (2008) Stress the worms U.S. National Library of Medicine National Institutes of Health PubMed Search:All DatabasesPubMedProteinNucleotideGSSESTStructureGenomeBioSampleBioSystemsBooksCancerChromosomesConserved DomainsdbGaPdbVar3D DomainsEpigenomicsGeneGenome ProjectGENSATGEO ProfilesGEO DataSetsHomoloGeneJournalsMeSHNCBI Web SiteNLM CatalogOMIAOMIMPeptidomePMCPopSetProbeProtein ClustersPubChem BioAssayPubChem CompoundPubChem SubstanceSNPSRATaxonomyToolKitToolKitAllUniGeneUniSTS SearchClear Limits Advanced search Help RSS SettingsSearch: Number of items displayed:510152050100 Feed name: Create RSS var d = document.getElementById('search_term'); if (d) {d.focus();} Abstract Display Settings: FormatSummary Summary (text) MEDLINE Abstract (text) XML PMID List Apply Send to: jQuery(document).ready( function () { jQuery("#send_to_menu input[type='radio']").click( function () { var selectedValue = jQuery(this).val().toLowerCase(); var selectedDiv = jQuery("#send_to_menu div." + selectedValue); if(selectedDiv.is(":hidden")){ jQuery("#send_to_menu div.submenu:visible").slideUp(); selectedDiv.slideDown(); } }); }); jQuery("#sendto").bind("ncbipopperclose", function(){ jQuery("#send_to_menu div.submenu:visible").css("display","none"); jQuery("#send_to_menu input[type='radio']:checked").attr("checked",false); }); Choose DestinationFile Clipboard Collections E-mail Order FormatSummary (text)Abstract (text)MEDLINEXMLPMID List 1 selected item: 20579881 Create File FormatSummarySummary (text)AbstractAbstract (text)MEDLINEXMLPMID ListMeSH and Other Data Additional text Add to Clipboard E-mail"SPAM" filtering software notice Add to Collections Order articles Curr Biol. 2010 Jul 27;20(14):1321-5. Epub 2010 Jun 24. Brenner JL, Jasiewicz KL, Fahley AF, Kemp BJ, Abbott AL. Loss of individual microRNAs causes mutant phenotypes in sensitized genetic backgrounds in C. elegans. Department of Biological Sciences, Marquette University, Milwaukee, WI 53201, USA. Comment in: Curr Biol. 2010 Jul 27;20(14):R598-600. MicroRNAs (miRNAs) are small, noncoding RNAs that regulate the translation and/or stability of their mRNA targets. Previous work showed that for most miRNA genes of C. elegans, single-gene knockouts did not result in detectable mutant phenotypes. This may be due, in part, to functional redundancy between miRNAs. However, in most cases, worms carrying deletions of all members of a miRNA family do not display strong mutant phenotypes. They may function together with unrelated miRNAs or with non-miRNA genes in regulatory networks, possibly to ensure the robustness of developmental mechanisms. To test this, we examined worms lacking individual miRNAs in genetically sensitized backgrounds. These include genetic backgrounds with reduced processing and activity of all miRNAs or with reduced activity of a wide array of regulatory pathways. With these two approaches, we identified mutant phenotypes for 25 out of 31 miRNAs included in this analysis. Our findings describe biological roles for individual miRNAs and suggest that the use of sensitized genetic backgrounds provides an efficient approach for miRNA functional analysis. Curr Biol. 2010 February 23; 20(4): 367–373. PMCID: PMC2844791 Published online 2010 January 21. doi: 10.1016/j.cub.2009.12.051. HHMIMSID: HHMIMS185696 Copyright notice and Disclaimer Many families of Caenorhabditis elegans microRNAs are not essential for development or viability Howard Hughes Medical Institute, Department of Biology, MIT, 77 Massachusetts Avenue, Cambridge, MA 02139, USA Ezequiel Alvarez-Saavedra and H. Robert Horvitz Corresponding author. Email: horvitz@mit.edu; FAX (617) 253-8126 The publisher's final edited version of this article is available at Curr Biol See other articles in PMC that cite the published article.  Other Sections▼ Publisher's Disclaimer Summary Results and Discussion Experimental Procedures Supplementary Material References MicroRNAs (miRNAs) are approximately 23 nt regulatory RNAs that posttranscriptionally inhibit the functions of protein-coding mRNAs. We previously found that most C. elegans miRNAs are individually not essential for development or viability and proposed that paralogous miRNAs might often function redundantly 1. To test this hypothesis, we generated mutant C. elegans strains that each lack multiple or all members of one of 15 miRNA families Loss of individual microRNAs causes mutant phenotypes in sensitized genetic backgrounds in C. elegans. Brenner et al, … Abbott. Curr Biol. (2010) Visible Phenotypes for 25 of 31 miRNA genes

microRNAs Are Embedded Within Diverse Networks • Redundancy between microRNA families microRNAs Are Embedded Within Diverse Networks mir-34 Gonadal Morphogenesis Argonaute mir-83 • Redundancy with gene regulatory “hubs” Robustness thru Redundancy Fertility mir-1 U.S. National Library of Medicine National Institutes of Health PubMed Search:All DatabasesPubMedProteinNucleotideGSSESTStructureGenomeBioSampleBioSystemsBooksCancerChromosomesConserved DomainsdbGaPdbVar3D DomainsEpigenomicsGeneGenome ProjectGENSATGEO ProfilesGEO DataSetsHomoloGeneJournalsMeSHNCBI Web SiteNLM CatalogOMIAOMIMPeptidomePMCPopSetProbeProtein ClustersPubChem BioAssayPubChem CompoundPubChem SubstanceSNPSRATaxonomyToolKitToolKitAllUniGeneUniSTS SearchClear Limits Advanced search Help RSS SettingsSearch: Number of items displayed:510152050100 Feed name: Create RSS var d = document.getElementById('search_term'); if (d) {d.focus();} Abstract Display Settings: FormatSummary Summary (text) MEDLINE Abstract (text) XML PMID List Apply Send to: jQuery(document).ready( function () { jQuery("#send_to_menu input[type='radio']").click( function () { var selectedValue = jQuery(this).val().toLowerCase(); var selectedDiv = jQuery("#send_to_menu div." + selectedValue); if(selectedDiv.is(":hidden")){ jQuery("#send_to_menu div.submenu:visible").slideUp(); selectedDiv.slideDown(); } }); }); jQuery("#sendto").bind("ncbipopperclose", function(){ jQuery("#send_to_menu div.submenu:visible").css("display","none"); jQuery("#send_to_menu input[type='radio']:checked").attr("checked",false); }); Choose DestinationFile Clipboard Collections E-mail Order FormatSummary (text)Abstract (text)MEDLINEXMLPMID List 1 selected item: 20579881 Create File FormatSummarySummary (text)AbstractAbstract (text)MEDLINEXMLPMID ListMeSH and Other Data Additional text Add to Clipboard E-mail"SPAM" filtering software notice Add to Collections Order articles Curr Biol. 2010 Jul 27;20(14):1321-5. Epub 2010 Jun 24. Brenner JL, Jasiewicz KL, Fahley AF, Kemp BJ, Abbott AL. Loss of individual microRNAs causes mutant phenotypes in sensitized genetic backgrounds in C. elegans. Department of Biological Sciences, Marquette University, Milwaukee, WI 53201, USA. Comment in: Curr Biol. 2010 Jul 27;20(14):R598-600. MicroRNAs (miRNAs) are small, noncoding RNAs that regulate the translation and/or stability of their mRNA targets. Previous work showed that for most miRNA genes of C. elegans, single-gene knockouts did not result in detectable mutant phenotypes. This may be due, in part, to functional redundancy between miRNAs. However, in most cases, worms carrying deletions of all members of a miRNA family do not display strong mutant phenotypes. They may function together with unrelated miRNAs or with non-miRNA genes in regulatory networks, possibly to ensure the robustness of developmental mechanisms. To test this, we examined worms lacking individual miRNAs in genetically sensitized backgrounds. These include genetic backgrounds with reduced processing and activity of all miRNAs or with reduced activity of a wide array of regulatory pathways. With these two approaches, we identified mutant phenotypes for 25 out of 31 miRNAs included in this analysis. Our findings describe biological roles for individual miRNAs and suggest that the use of sensitized genetic backgrounds provides an efficient approach for miRNA functional analysis. Curr Biol. 2010 February 23; 20(4): 367–373. PMCID: PMC2844791 Published online 2010 January 21. doi: 10.1016/j.cub.2009.12.051. HHMIMSID: HHMIMS185696 Copyright notice and Disclaimer Many families of Caenorhabditis elegans microRNAs are not essential for development or viability Howard Hughes Medical Institute, Department of Biology, MIT, 77 Massachusetts Avenue, Cambridge, MA 02139, USA Ezequiel Alvarez-Saavedra and H. Robert Horvitz Corresponding author. Email: horvitz@mit.edu; FAX (617) 253-8126 The publisher's final edited version of this article is available at Curr Biol See other articles in PMC that cite the published article.  Other Sections▼ Publisher's Disclaimer Summary Results and Discussion Experimental Procedures Supplementary Material References MicroRNAs (miRNAs) are approximately 23 nt regulatory RNAs that posttranscriptionally inhibit the functions of protein-coding mRNAs. We previously found that most C. elegans miRNAs are individually not essential for development or viability and proposed that paralogous miRNAs might often function redundantly 1. To test this hypothesis, we generated mutant C. elegans strains that each lack multiple or all members of one of 15 miRNA families Loss of individual microRNAs causes mutant phenotypes in sensitized genetic backgrounds in C. elegans. Brenner et al, 2010

Distinct MicroRNAs with Convergent Targets Gonadal Morphogenesis Buffering morphogenetic processes against temperature changes B-integrin PAT-3 PEB-1 mir-34 mir-83 pat-3 mRNA Buffered against Temperature changes Gonadal Morphogenesis peb-1 mRNA Transcription factor Samantha Burke & Molly Hammell

Hermaphrodite Gonad Morphogenesis in C. elegans Phase 1 Phase 2 Phase 3 From Worm Atlas

Migration Defects in mir-34 (-/-) and mir-83 (-/-) Mutants Samantha Burke & Molly Hammell

Taking a Cue from Richard Carthew…. Drosophila mir-7 Buffers Eye Development Against Temperature Changes Li et al., Carthew Cell 2009 137(2): 273-282

Temperature Oscillations Aggravate mir-34 & mir-83 Phenotypes Constant 20 ℃ 15oC – 25oC Oscillations (8 hr) Samantha Burke & Molly Hammell

Samantha Burke & Molly Hammell *** 54 % defective gonadal migration 19 14 2 mir-83(+) mir-83(0) mir-83(+) mir-83(0) mir-34(+) mir-34(+) mir-34(0) mir-34(0) Samantha Burke & Molly Hammell

Distinct MicroRNAs with Convergent Targets Gonadal Morphogenesis Buffering morphogenetic processes against temperature changes B-integrin PAT-3 PEB-1 mir-34 mir-83 pat-3 mRNA Buffered against Temperature changes Gonadal Morphogenesis peb-1 mRNA Transcription factor Samantha Burke & Molly Hammell

Modulation of microRNA levels and (lin-4) activity Reprogramming of HBL-1 microRNA regulation by life history Post-dauer: mir-48, mir-84, mir-241, let-7 lin-4: MAJOR Role mir-48, mir-84, mir-241, let-7 lin-4: minor role Continuous: NHL-2 AGO An let-7 Family lin-4 HBL-1 mRNA Modulation of microRNA levels and (lin-4) activity Xantha Karp

Accommodation of Stress and Diapause in C. elegans Development Unfavorable Favorable Dauer- interrupted 1 Insulin/IGF DAF-16/Fox0 2 Dauer larva Larval stages 3 4 Adult Continuous

Utterly Robust Cell Fate Specification and Execution lin-4 and let-7 microRNAs control cell fate progression Embryo 1 lin-14 lin-4 2 hbl-1 Larval stages 7-Fam (Optional) Developmental Quiescence 3 let-7 lin-41 4 lin-14 ..C ACCAA C.. UCACA CUCAGGGA lin-4 AGUGU GAGUCCCU G A A C ACUC lin-41 ...U AUU U.. UUAUACAACC CUGCCUC GAUAUGUUGG GAUGGAG let-7 UU AU U hbl-1 ..A CUUGU U.. AACUA CC GCUACCUUA UUGAU GG UGAUGGAGU mir-84 AUGUU A Adult Adult

lin-4 and let-7 microRNAs control cell fate progression Embryo 1 lin-14 lin-4 2 hbl-1 Larval stages 7-Fam (Optional) Developmental Quiescence 3 Dauer larva let-7 lin-41 4 Adult Adult Robust Timing of cell fates

microRNAs in C. elegans cell fate progression Developmental Signals Adult L1 L2 L4 L3 miR-48 miR-84 miR-241 let-7 lin-4 Wild type LIN-29 LIN-41 lin-4 let-7 HBL-1 LIN-14 L1 L2 L3 L4 Ad let-7Fam mir-48 mir-84 mir-241 LIN-28 Developmental Signals Dauer Larva Quiescence Robustness of L2 to L3: Redundancy of let-7 family microRNAs Shared regulationof hbl by lin-4 and let-7 fam MicroRNA pathways Transcription Factors Robust Timing of cell fates

Dosage-Sensitive activity of let-7-Family microRNAs UGAGGUAGUAGGUUGUAUAGUU UGAGGUAGGCUCA-GUAGAUGC UGAGGUAGUAUGUAAUAUUGUA UGAGGUAGGUGCGAGAAAUGA- Worm let-7-Family Wild type let-7-Fam -1 L1 L1 L2 L3 L4 Ad lin-4 LIN-14 LIN-28 L2 let-7Fam mir-48 mir-84 mir-241 let-7 HBL-1 Developmental Signals L3 L4 let-7 LIN-41 LIN-29 Ad

Dosage-Sensitive activity of let-7-Family microRNAs UGAGGUAGUAGGUUGUAUAGUU UGAGGUAGGCUCA-GUAGAUGC UGAGGUAGUAUGUAAUAUUGUA UGAGGUAGGUGCGAGAAAUGA- Worm let-7-Family let-7-Fam -3 Wild type L1 L1 L2 L3 L4 Ad lin-4 LIN-14 LIN-28 L2 HBL-1 let-7Fam mir-48 mir-84 mir-241 let-7 HBL-1 Developmental Signals L3 L4 Ad L3 L4 L2 let-7 LIN-41 LIN-29 Normal Retarded Adult-specific col-19::GFP

Retarded phenotype of let-7-Fam -3 mutant Adult-specific col-19::GFP Normal Adult Retarded Adult

Stressful environment Developmental Signals Post-dauer Development of let-7-Fam -3 mutant let-7-Fam -3 let-7-Fam -3 Stressful environment Healthy environment L1 lin-4 LIN-14 LIN-28 L2 HBL-1 HBL-1 let-7Fam mir-48 mir-84 mir-241 let-7 Developmental Signals Dauer Larva Quiescence Ad L3 L4 L2 L3 L4 let-7 LIN-41 LIN-29 Normal Retarded “Post-dauer” Suppression

Adult-expression of col-19::GFP Post-Dauer Suppression of let-7-Fam -3 Phenotypes Wild Type let-7-Fam-3 Continuous Post-dauer Continuous Post-dauer Adult-expression of col-19::GFP

Stressful environment Post-dauer Suppression of let-7-Fam -3 Phenotypes let-7-Fam -3 let-7-Fam -3 High Pheromone Low Pheromone Healthy environment Stressful environment L1 lin-4 LIN-14 LIN-28 L2 Mod HBL-1 let-7Fam mir-48 mir-84 mir-241 let-7 Developmental Signals Dauer Larva Quiescence Ad L3 L4 let-7 LIN-41 LIN-29 Normal Retarded Xantha Karp Post-Dauer Suppression

Developmental Signals Gene products required for Post-dauer Suppression Mod(0); let-7-Fam -3 let-7-Fam -3 let-7-Fam -3 High Pheromone Low Pheromone L1 lin-4 LIN-14 LIN-28 L2 Mod HBL-1 HBL-1 let-7Fam mir-48 mir-84 mir-241 let-7 Developmental Signals Dauer Larva Quiescence Ad L3 L4 L2 L3 L4 let-7 LIN-41 LIN-29 Retarded Normal Retarded Xantha Karp Post-Dauer Suppression

Developmental Signals NHL-2/TRIM32 is required for Post-dauer Suppression let-7-Fam -3 let-7-Fam -3 High Pheromone Low Pheromone L1 lin-4 LIN-14 LIN-28 L2 NHL-2 HBL-1 let-7Fam mir-48 mir-84 mir-241 let-7 Developmental Signals Dauer Larva Quiescence Ad L3 L4 let-7 LIN-41 LIN-29 Normal Retarded Xantha Karp “Post-Dauer” Suppression

Developmental Signals NHL-2/TRIM32 is required for Post-dauer Suppression nhl-2(0); let-7-Fam -3 nhl-2(0); let-7-Fam -3 High Pheromone Low Pheromone L1 lin-4 LIN-14 LIN-28 L2 NHL-2 HBL-1 HBL-1 let-7Fam mir-48 mir-84 mir-241 let-7 Developmental Signals Dauer Larva Quiescence Ad L3 L4 L2 L3 L4 let-7 LIN-41 LIN-29 Retarded Normal Retarded Xantha Karp “Post-Dauer” Suppression

Col-19::GFP expression in Post-Dauer Adults NHL-2/TRIM32 is required for Post-dauer Suppression Col-19::GFP expression in Post-Dauer Adults Post-Dauer let-7-Fam-3 Post-Dauer nhl-2; let-7-Fam-3

Developmental Signals lin-4 microRNA is required for Postdauer Suppression lin-4(0); let-7-Fam -3 let-7-Fam -3 lin-4(0); let-7-Fam -3 let-7-Fam -3 High Pheromone Low Pheromone L1 lin-4 LIN-14 LIN-28 L2 NHL-2 HBL-1 HBL-1 let-7Fam mir-48 mir-84 mir-241 let-7 Developmental Signals Dauer Larva Quiescence Ad L3 L4 L2 L3 L4 let-7 LIN-41 LIN-29 Retarded Normal Retarded Xantha Karp “Post-Dauer” Suppression

HBL-1::GFP::UTR-HBL-1 lin-4 is required for down regulation of HBL-1 Between L2 and Post Dauer L3 L1 L2 Dauer larva Post Dauer L3 WT WT WT WT Post Dauer L3 let-7-Fam-3 L1 L2 Dauer larva Post Dauer L3 Down Regulated HBL-1::GFP::UTR-HBL-1 lin-4; let-7-Fam-3 Not Down Regulated

Developmental Signals lin-4 function is More Critical after Dauer Larva Quiescence lin-4(0); let-7-Fam -1 let-7-Fam -1 lin-4(0); let-7-Fam -1 let-7-Fam -1 High Pheromone Low Pheromone L1 lin-4 LIN-14 LIN-28 L2 L2 NHL-2 HBL-1 HBL-1 let-7Fam mir-48 mir-84 mir-241 let-7 Developmental Signals Dauer Larva Quiescence Ad L3 L4 L2 L3 L4 Ad L3 L4 let-7 LIN-41 LIN-29 Retarded Normal Xantha Karp

lin-4 microRNA is More Critical after Dauer Larva Quiescence Continuous mir-84(0) Post-Quiescence ** lin-4(0); mir-84(0) Continuous ** Post-Quiescence ** P < 0.01 % Adults expressing larval cell fates *All strains contain lin-14(n179) Xantha Karp

Dauer Traversing vs Continuously-Developing Developmental profiles of lin-4 and let-7-Family microRNAs Taqman Q-RT/PCR Dauer Traversing vs Continuously-Developing lin-4 mir-84 let-7 mir-241 mir-48 microRNA abundance Dauer vs Continuous 1.0 L2D/L2 Dauer/L2m PDL3/L3 PDL4/L4

Modulation of microRNA levels and (lin-4) activity Reprogramming of HBL-1 microRNA regulation by life history Post-dauer: mir-48, mir-84, mir-241, let-7 lin-4: MAJOR Role Insulin/IGF DAF-16/Fox0 mir-48, mir-84, mir-241, let-7 lin-4: minor role Continuous: NHL-2 AGO An let-7 Family lin-4 HBL-1 mRNA Modulation of microRNA levels and (lin-4) activity Xantha Karp

Physiological Modulation of microRNA activity Enhancers and suppressors of let-7-Family loss-of-function mutations Zhiji Ren, Chris Hammell col-19 Alae Description rab-7 enhance endosomal trafficking vps-11 vps-33.1/33.2 suppress pqn-29 prion like gene pqn-67 C01A2.4 (CHMP2B) ESCRT complex nhl-2 miRISC modulator cgh-1 miRISC essential component lin-46 scaffolding protein

Physiological Modulation of microRNA activity Bacterial Diet Zhiji Ren

let-7-Family microRNAs in Diet and Development Developmental cell fate Bacterial Quality/Toxicity Metabolic Signaling Innate Immunity Developmental cell fate specification mir-84 let-7 Buffering against food stress mir-48 mir-241

Developmental Timing, Robustness and Stress Responses Current: Former: Zhiji Ren Molly Hammell Chris Hammell Samantha Burke Xantha Karp Omid Harandi Sungwook Choi LIN-28 Function Rosalind Lee Circulating microRNAs in human plasma and CSF Katie McJunkin Regulation of microRNA stability/turnover Maria Ow MicroRNAs in diverse stress responses Catherine Sterling microRNAs and long noncoding RNAs Elizabeth Thatcher Alexey Wolfson Anna Zinovyeva