Human Respiratory Syncytial Virus (RSV) is the most common cause of bronchiolitis and pneumonia among infants and children, with almost everyone having.

Slides:



Advertisements
Similar presentations
Paramyxoviruses and Rhabdoviruses Paramyxoviridae and Rhabdoviridae
Advertisements

Section G Gene manipulation
Emerging Infectious Disease (EID) involving Respiratory Tract
You start with a biologically relevant protein from a pathogen (Bacterium, virus, parasite…)
Designing and Optimizing an Adenovirus Encoded VLP Vaccine against HIV Anne-Marie Andersson PhD Student, University of Copenhagen.
Jenny Patoka, Rizwana Ali, and Matthew D. Koci Department of Poultry Science, North Carolina State University, Raleigh, NC Introduction Astroviruses are.
Introduction: How to Clone a gene?
TOOLS OF GENETIC ENGINEERING
Genetic Mutations A mutation alters the nucleotide sequence in DNA, which can cause a change in the amino acid structure of the corresponding protein,
Construction, Transformation, and Prokaryote Expression of a Fused GFP and Mutant Human IL-13 Gene Sequence Lindsay Venditti, Department of Biological.
Definitions: 1. Genetic engineering- remaking genes for practical purposes 2. Recombinant DNA- DNA made from two or more different organisms 3. Restriction.
Gene Technology Chapters 11 & 13. Gene Expression 0 Genome 0 Our complete genetic information 0 Gene expression 0 Turning parts of a chromosome “on” and.
 What is a genome?  A genome is an organism’s full collection of genes.  Why do cells need to control gene expression?  Cells need to control gene.
Section G Gene manipulation
Biotechnology.
Luciferase Based Plasmid Reporter System for the Detection and Quantification of Human Respiratory Syncytial Virus Group 14: Oral Report 2, 1/24/2008 Melanie.
-The methods section of the course covers chapters 21 and 22, not chapters 20 and 21 -Paper discussion on Tuesday - assignment due at the start of class.
Display of the Viral Epitopes on Lactococcus lactis: A Model for Food Grade Vaccine against EV71.
11/1/2009 Biology 11.1 Gene Technology Gene Technology.
Cloning and rDNA (II) Dr. Abdulaziz Almalik
Creating an RNAi feeding vector How does ligation into L4440 work?
Study Guide- Gene Technology 1.a. Inbreeding: Breeding of an organism with the same characteristics. Causes genetic disorders. b. Hybridization: Crossing.
Genetic Technologies Manipulating & Cloning DNA.
Electrophoresis. A process that is used to sort fragments of DNA by placing the digested DNA in a special gel and adding electricity.
19.1 Techniques of Molecular Genetics Have Revolutionized Biology
AP Biology DNA Study Guide. Chapter 16 Molecular Basis of Heredity The structure of DNA The major steps to replication The difference between replication,
 Translation Creating Protein from mRNA Protein Structure  Proteins are made of Amino Acids.  There are 20 different Amino Acids.  The sequence of.
Gene Technology Chapter Basic Steps of Genetic Engineering Genetic Engineering – process of manipulating genes for practical purposes Genetic.
Biotechnology Practice Test. Question #1 An organism’s chromosomes are part of its a) plasmid b) recombinant DNA c) genome d) enzymes.
Biotechnology Chapter 17.
PHARMACOBIOTECHNOLOGY.  Recombinant DNA (rDNA) is constructed outside the living cell using enzymes called “restriction enzymes” to cut DNA at specific.
Group 4 Data Diane Meas The 3 A-Michaels (get it??) 3 amigos… a-michaels….
BIOTECHNOLOGY.
Jessica M. Boehmler* and Jeffrey P. Thompson Department of Biological Sciences, York College of Pennsylvania ABSTRACT Botulinum neurotoxin (botox), found.
Paramyxoviruses Stanley I. Martin, MD Associate Professor Division of Infectious Diseases.
Studying the genomes of organisms GENE TECHNOLOGY.
paramyxo.ppt Paramyxoviruses paramyxo.ppt.
Genetic Engineering Genetic engineering is also referred to as recombinant DNA technology – new combinations of genetic material are produced by artificially.
8.1 - Manipulating & Cloning DNA
Genetic Engineering/ Recombinant DNA Technology
Figure 5: Expression and solubility tests for constructs of CoVs. Coronaviruses are complex, positive-sense RNA viruses that cause mild to severe respiratory.
MOLECULAR BIOLOGY IN ACTION In this project, students will use what they have learned in the previous courses to complete a larger multi-step molecular.
?. gfp-gene as cDNA in a host-DNA-fragment E. coli (new host)  gfp ? ??????? Aequorea victoria (donor) host.
Relationship between Genotype and Phenotype
Unit Gene Expression and Replication in Small DNA Viruses Microviridae Small DNA Viruses of Animals (Papovaviruses)
Steps to Recombinant DNA 1) Isolate the foreign DNA fragment 2) Attach DNA fragment to a “vehicle” called a Vector 3) Transfer the vector into a host.
Gene Cloning & Creating DNA Libraries. Клонирование генов Что означает термин «клонирование»? Как происходит клонирование генов? Чем это отличается от.
General, Organic, and Biological Chemistry Copyright © 2010 Pearson Education, Inc Viruses Chapter 21 Nucleic Acids and Protein Synthesis.
اختبارات التعادل المناعي:Neutralization Tests:
Irina Callens 18/06/2015 EXPRESSION AND ROLE OF A CYPRINID HERPESVIRUS-3 MICRORNA.
Non-Influenza Respiratory Virus Vaccines Larry J. Anderson DVD, NCIRD, CDC Atlanta, GA, USA 41 st National Immunization Conference Kansas City, Missouri.
Figure S1. Production of recombinant NS1 protein
Sesha Kiran Kollipara, Vikas Solanki and Bikash Mandal
Respiratory Syncytial Virus (RSV) Ekaterina Kinnear & Ryan Russell, Imperial College London Importance RSV is a major cause of disease in childhood and.
Topics to be covers Basic features present on plasmids
4/26/2010 BIOTECHNOLOGY.
Ahangarzadeh, Sh. *1 Bandehpour, M.1, Kazemi, B.1 , Yarian, F.1
Molecular Genetic Analysis and Biotechnology
Biotechnology Practice Test
16 S ribosomal DNA TGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTTGAGTCTTGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATA
Interferons: Type I José Ignacio Saldana, Imperial College London, UK
Shahid Bahonar University of Kerman
Relationship between Genotype and Phenotype
Genetic Engineering and Gene Expression
Relationship between Genotype and Phenotype
How are areas of DNA that don’t code for proteins (genes) used by our cells? How can we make use of these areas?
Presentation Topic Cloning Vector and its Types Presented By
Skin-Specific Expression of ank-393, a Novel Ankyrin-3 Splice Variant
Restriction Endonuclease
Volume 7, Issue 1, Pages (January 2003)
Presentation transcript:

Human Respiratory Syncytial Virus (RSV) is the most common cause of bronchiolitis and pneumonia among infants and children, with almost everyone having contracted RSV at least once by the age of 2.

Family: Paramyxoviridae Genus: Pneumovirus Negative sense single strand RNA virus translated into 11 proteins

To design a multivalent vaccine against Respiratory Syncytial Virus Multivalent- having several sites of attachment for an antibody or antigen. In this case F, M2, & G proteins.

Viral penetration Syncytium formation High titers of neutralizing antibodies Syncytia

Aides in the attachment of the virus to the host. Has epitopes recognized by the host antibody response.

M2-1:Transcription elongation factor M2-2:Regulates viral transcription Induces CD8 T-cells

Entire length of F gene = omitted on purpose

Entire length of M2 gene = omitted on purpose

Entire length of G gene = omitted on purpose

Sal I- R.E. digestion endNco I- R.E. digestion end

Sal I Nco I

Restriction enzyme analysis of multivalent gene on agarose gel Lane-1: 1kb ladder Lane-2: RFM2G cut with Nco I Lane-3: pET-32 cut with Nco I and Sal I Lane-4: RFM2G cut with Nco I and Sal I Lane-5: 100kb ladder

CLONING PROTEIN EXPRESSION PROTEIN PURIFICATION IMMUNIZATION

E. coli BL21 cells pET-32 with FM2G Protein expression

Lane-1: SDS-Marker Lane-2: Cytoplasmic Extract Lane-3: Soluble Fraction Lane-4: Pellet Lane-5: Purified FM2G protein 38KDa

Lane-1: Pellet Lane-2: Soluble Fraction Lane-3: Cytoplasmic Extract Lane-4: Magic Marker KDa

Multivalent gene cloned into pET-32a vector Successful transformation Successful protein expression Confirmation analyses identified the created protein Immunization testing in various specimens is presently ongoing

1. Collins, P.L., et al., Nucleotide sequences for the gene junctions of human respiratory syncytial virus reveal distinctive features of intergenic structure and gene order. PNAS, : p Domachowske, J.B. and H.F. Rosenberg, Respiratory syncytial virus infection: immune response, immunopathogenesis, and treatment. Clin. Micro. Rev., (2): p Hacking, D. and J. Hull., Respiratory syncytial virus- Viral biology and the host response. Journal of infection., : p