Section H Cloning Vectors Molecular Biology Course Section H Cloning Vectors

vectors Cloning vectors: to clone a gene in a vector Introduction vectors Cloning vectors: to clone a gene in a vector Expression vectors: allowing the exogenous DNA to be inserted, stored, and manipulated mainly at DNA level Integration vectors: allowing the exogenous DNA to be inserted, stored, and expressed.

H2 Bacteriophage vectors H3 Cosmids and YACs H4 Eukaryotic vectors Cloning vectors H1 Plasmid vecters H2 Bacteriophage vectors H3 Cosmids and YACs H4 Eukaryotic vectors

H1 Design of Plasmid Vectors Cloning vectors H1 Design of Plasmid Vectors H1-1 A plasmid vector for cloning H1-2 A plasmid vector for gene expression

H1-1 A plasmid vector for cloning H1 Design of Plasmid Vectors H1-1 A plasmid vector for cloning autonomously replicating independent of host’s genome. Easily to be isolated from the host cell. (Plasmid preparation) Selective markers: Selection of cells (1) Containing vector: one marker is enough (2) Containing ligation products: # twin antibiotic resistance # blue-white screening 4. Contains a multiple cloning site (MCS)

Ampicillin resistant? yes yes Tetracycline resistant? No yes Screening by insertional inactivation of a resistance gene Ampr Tcr ori pBR322 B X B B Tcr Ampr Ampr X B ori ori Ampicillin resistant? yes yes Tetracycline resistant? No yes

H1 Design of Plasmid Vectors Replica plating: transfer of the colonies from one plate to another using absorbent pad or Velvet (绒布). transfer of colonies +ampicillin + ampicillin + tetracycline these colonies have bacteria with recombinant plasmid

H1 Design of Plasmid Vectors

Blue white screening H1 Design of Plasmid Vectors Lac promoter Ampr Screening by insertional inactivation of the lacZ gene Lac promoter MCS (Multiple cloning sites, 多科隆位点） Ampr pUC18 (3 kb) lacZ’ ori The insertion of a DNA fragment interrupts the ORF of lacZ’ gene, resulting in non-functional gene product that can not digest its substrate x-gal.

H1 Design of Plasmid Vectors lacZ encode enzyme b-galactosidase lac promoter (substrate of the enzyme) X-gal IPTG Blue product The expression of active b-galactosidase has to be vector dependent for the selection purpose lacZ’: a shortened derivative of lacZ, encoding N-terminal a-peptide of b-galactosidase. Host strain for vectors containing lacZ’: contains a mutant gene encoding only the C-terminal portion of b-galactosidase which can then complement the a-peptide to produce the active enzyme

H1 Design of Plasmid Vectors Recreated vector: blue transformants Recombinant plasmid: containing inserted DNA: white transformants Recreated vector (no insert) Recombinant plasmid (contain insert)

Multiple cloning sites H1 Design of Plasmid Vectors Multiple cloning sites Multiple restriction sites enable the convenient insertion of target DNA into a vector Ampr ori pUC18 (3 kb) MCS (Multiple cloning sites, 多科隆位点） Lac promoter lacZ’ …ACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCA… . T h rA s n S er S e r Val Pro Gly Asp Pro Leu Glu Ser Thr Cys Arg His Ala Ser… EcoRI SacI KpnI SmaI XmaI BamHI XbaI SalI HincII AccI PstI SphI Lac Z

H1-2 A plasmid vector for gene expression H1 Design of Plasmid Vectors H1-2 A plasmid vector for gene expression Expression vectors: allowing the exogenous DNA to be inserted, stored and expressed. Promoter and terminator for RNA transcription are required. Intact ORF and ribosomal binding sites (RBS) are required for translation.

Some cloning vector can be used to transcribe a gene. (pUC vectors) H1 Design of Plasmid Vectors Some cloning vector can be used to transcribe a gene. (pUC vectors) Special transcriptional vectors: pGEM series containing promoters from bacteriophages T7 and SP6 for in vitro transcription with the corresponding polymerases. Expression vector (transcription & translation).

H1 Design of Plasmid Vectors Ampr ori pUC18 (3 kb) MCS (Multiple cloning sites, 多科隆位点） Lac promoter lacZ’ The ORF of the inserted gene has to be in the same direction as that of the lacZ A fusion protein contains the N-terminal sequence of lacZ and the inserted ORF will be produced

(transcription & translation). H1 Design of Plasmid Vectors Expression vector (transcription & translation). Promoters lacUV-5: a mutant lac promoter which is independent of cAMP receptor protein. (constitutive expression) lPL promoter Phage T7 promoter Fused proteins Individual proteins

T7 expression vector H1 Design of Plasmid Vectors T7 promoter RBS Start codon MCS Ampr Transcription terminator T7 expression vector ori

Fused proteins Lac fusions: (discussed) H1 Design of Plasmid Vectors Fused proteins Lac fusions: (discussed) His-tag fusions: A sequence encodes His-tag was inserted at the N- terminus of the target ORF, which allows purification of the fusion protein to be purified by binding to Ni2+ column.

H2 Bacteriophage vector Cloning vectors H2 Bacteriophage vector Tow examples: H2-1 λ phage bacteriophageλ λ replacement vector H2-2 M13 phage M13 phage vector Cloning in M13 Hybrid plasmid-M13 vectors

λ phage H2 Bacteriophage vector viruses that can infect bacteria. 48.5 kb in length Linear or circular genome (cos ends) Lytic phase (Replicate and release) Lysogenic phase (integrate into host genome)

H2-1λ phage H2 Bacteriophage vector cos cos Exogenous DNA (~20-23 kb) Protein coat DNA Long (left) arm short (right) arm cos Nonessential region cos Exogenous DNA (~20-23 kb)

The phage λ cos ends H2 Bacteriophage vector 5‘-CGGGGCGGCGACCTCG-3’ 3’-GCCCCGCCGCTGGAGC-5’ Cleavage Ligation (during packaging) (after infection) GGGCGGGCGACCTCG-3’ 5’-CG + GC-5’ 3’-GCCCCGCCGCTGGA Circular form Linear form

H2 Bacteriophage vector

H2 Bacteriophage vector λ replacement vector Replace the nonessential region of the phage genome with exogenous DNA (~ 20 kb) high transformation efficiency (1000-time higher than plasmid)

H2 Bacteriophage vector λ replacement vector 2. Packing with a mixture of the phage coat proteins and phage DNA-processing enzymes Ligation 3. Infection and formation of plaques

H2 Bacteriophage vector Plaques: the clear areas within the lawn where lysis and re-infection have prevented the cells from growing. Recombinant l DNA may be purified from phage particles from plaques or from liquid culture.

lysogens in cloning techniques H2 Bacteriophage vector lysogens in cloning techniques Genes or foreign sequences may be incorporated essentially permanently into the genome of E.coli by integration of a  vector containing the sequence of interest.

H2-2 M13 phage H2 Bacteriophage vector A filamentous phage Phage particles contain a 6.7kb circular single strand of DNA. After infection of a sensitive E.coli host,the complementary strand is synthesized,and the DNA replicated as a double-stranded circle,the replicative form(RF) with about 100 copies per cell. Contrasting to phage ,the cell are not lysed by M13,but continue to grow slowly,and single-stranded forms are continuously packaged and released from the cells as new phage particles.

M13 phage vectors H2 Bacteriophage vector Replication form (RF, dsDNA) of M13 phage can be purified and manipulated like a plamid. Phage particles (ssDNA): DNA can be isolated in a single-stranded form DNA sequencing (Topic J2) Site-directed mutagenesis (Topic J5) Cloning (RF, like plasmid)  transfection (recombinant DNA)  growth (plating on a cell lawn)  plaques formation (slow growth)

Blue-white selection

Hybrid plasmid-M13 vectors H2 Bacteriophage vector Hybrid plasmid-M13 vectors Small plasmid vectors (pBluescript) being developed to incorporate M13 functionality Contain both the plasmid and M13 origin of replication Normally propagate as true plasmids Can be induced to form single-stranded phage particles by infection of the host cell with a helper phage.

H3 Cosmids and YACs H3-1 Cloning large DNA fragments （> 20 kb) Cloning vectors H3 Cosmids and YACs H3-1 Cloning large DNA fragments （> 20 kb) H3-2 Cosmid vectors H3-3 YAC vectors H3-4 Selection in S. cerevisiae (啤酒酵母）

H3-1 Cloning large DNA fragments H3 Cosmids and YACs H3-1 Cloning large DNA fragments (Eukaryotic Genome project) Analysis of eukaryotic genes and the genome organization of eukaryotes requires vectors with a larger capacity for cloned DNA than plasmids or phage . Human genome (3 x 109 bp): large genome and large gene demand vectors with a large size capacity.

H3 Cosmids and YACs H3-2 Cosmid vectors Utilizing the properties of the phage l cos sites in a plasmid vector. A combination of the plasmid vector and the COS site which allows the target DNA to be inserted into the l head. The insert can be 37-52 kb.

Formation of a cosmid clone Digestion Ligation C) Packaging and infect

Cloning in a cosmid vector H3 Cosmids and YACs B cos SmaI Cloning in a cosmid vector S B B S cos cos B cos B

H3-3YAC vectors H3 Cosmids and YACs Can accommodate genomic DNA fragments of more than 1 Mb, and can be used to clone the entire human genome, but not good in mapping and analysis Essential components of YAC vectors : Centromers (CEN), telomeres (TEL) and autonomous replicating sequence (ARS) for proliferation in the host cell. ampr for selective amplification and markers such as TRP1 and URA3 for identifying cells containing the YAC vector in yeast cells. Recognition sites of restriction enzymes (e.g., EcoRI and BamHI)

H3 Cosmids and YACs Yeast selection

Cloning in YAC vector H3 Cosmids and YACs SnaB CEN4 ARS TRP1 SUP4: insertion site for red-white selection SUP4: CEN4 ARS TRP1 Cloning in YAC vector TEL B B TEL Digest with BamHI/SnaI Ligate with blunt ends Transfect into yeast

H3-4 Selection in S.cerevisiae H3 Cosmids and YACs H3-4 Selection in S.cerevisiae Saccharomyces cerevisiae selectable markers do not confer resistance to toxic substances Growth of yeast on selective media lacking specific nutrients can serve for selection. Auxotrophic yeast mutants (营养缺欠型) are made as host strains for plasmids containing the genes complementary to the growth defect . For example: TRP1 mutants can’t make tryptophan, and can only grow on media supplemented with tryptophan. The presence of a plasmid containing gene encoding tryptophane enables the cell to grow on media without tryptophan.

H4 Eukaryotic Vectors Transfection of eukarotic cells Shuttle vectors Cloning vectors H4 Eukaryotic Vectors Transfection of eukarotic cells Shuttle vectors H4-1 Yeast episomal plasmids (Yeasts) H4-2 Agrobacterium tumefaciens (农杆菌) Ti plasmid (Plants) H4-3 Baculovirus (Insects) H4-4 Mammalian viral vectors (Mammalian)

Transfection: more problematic than bacterial transformation H4 Eukaryotic Vectors Transfection: The take-up of DNA into eukaryotic cells more problematic than bacterial transformation Much lower efficiency in the progress Transfection methods Electroporation Microinjection liposome

H4 Eukaryotic Vectors Shuttle vectors Vectors contain sequences required for replication and selection in both E. coli and the desired host cells, so that the construction and many other manipulation of the recombinant plasmids can be completed in E. coli. Most of the eukaryotic vectors are constructed as shuttle vectors

H4 Eukaryotic Vectors A Shuttle vector MCS

H4-1 Yeast episomal plasmids (YEps) H4 Eukaryotic Vectors H4-1 Yeast episomal plasmids (YEps) Vectors for the cloning and expression of genes in Saccharomyces cerevisiae. Based on 2 micron (2m) plasmid which is 6 kb in length. One origin Two genes involved in replication A site-specific recombination protein FLP, homologous to l Int. 2. Normally replicate as plasmids, and may integrate into the yeast genome.

H4 Eukaryotic Vectors A YEp vector MCS Insert Figure 1

YEp vector H4 Eukaryotic Vectors Replicate as plasmid from 2m origin integrate by recombinantion

H4-2 Agrobacterium tumefaciens Ti plasmid H4 Eukaryotic Vectors H4-2 Agrobacterium tumefaciens Ti plasmid Ti plasmid 200kb T-DNA plant chromosome Integrated T-DNA Gene induce crown gall

H4 Eukaryotic Vectors crown gall or tumor

Recombinant Ti plasmid H4 Eukaryotic Vectors Recombinant Ti plasmid Place the target gene in the T-DNA region of a Ti plasmid, then transform the recombinant Ti plasmid. (WT is not good because of the crown gall formation) Recombinant T-DNA transformed into the A. tumefaciens cell carrying a modified Ti plasmid without T-DNA (T-DNA that are responsible for crown gall formation. The deleted T-DNA is called disarmed T-DNA shuttle vector).

H4 Eukaryotic Vectors Plant gene engineering using T-DNA vector

H4-3 Baculovirus Infects insect cells H4 Eukaryotic Vectors H4-3 Baculovirus Infects insect cells The strong promoter expressing polyhedrin protein can be used to over-express foreign genes engineered. Thus, large quantities of proteins can be produced in infected insect cells. Insect expression system is an important eukaryotic expression system.

H4-4 Mammalian viral vectors H4 Eukaryotic Vectors H4-4 Mammalian viral vectors SV40: 5.2 kb, can pack DNA fragment similar to phage l. Retroviruss: single-stranded RNA genome, which copy to dsDNA after infection. Have some strong promoters for gene expression Gene therapy

H4 Eukaryotic Vectors Gene transfer Genes may be transiently or permanently introduced into cultured eukaryotic cells without the use of vector in strict sense. Transient expression Integration