Genetics News EditBase Mystery Sequence EditBase format Pure text format Problem Set 4.

Slides:

Advertisements

Similar presentations

Genetics. Process of DNA being copied before cell division occurs Must make an exact copy or mutations will occur (which could be harmful) The 2 strands.

Advertisements

Changes in DNA.

The fat cat ate the wee rat ???

Central Dogma of Biology. How genes control biological activity.

Decoding DNA Worksheet

Mutations Section 12–4 This section describes and compares gene mutations and chromosomal mutations.

What happens when we change DNA? MUTATIONS.  What do you think a mutation is?  What happens to you during a mutation? MUTATIONS.

Mutations (p. 307) Mutations are changes in the genetic material. Mutations may be genetic mutations or chromosomal mutations.

Mutations. Now and then cells make mistakes in copying their own DNA, inserting an incorrect base or even skipping a base as a new strand is put together.

WHAT HAPPENS IF DNA HAS ERRORS?!!!

Chapter 12 : DNA and RNA What does DNA look like? What are the elements that makeup DNA?

Chapter 17 Notes From Gene to Protein.

1. Central Dogma DNA RNA PROTEIN  DNA is made of nucleotides of  Deoxyribose (sugar)  PO 4 (phosphate group)  Nitrogen bases  1. adenine—A  2.

WHEN DNA MAKES A COPY OF ITSELF. IN THE NUCLEUS!

GENE EXPRESSION & MUTATIONS IN DNA

8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.

MUTATIONS _______________ are changes in the genetic material. MUTATIONS mistakes REMEMBER! Mutations can happen when cells make _____________ in.

Genetics.  Process of DNA being copied before cell division occurs  Must make an exact copy or mutations will occur (which could be harmful)  The.

DNA Deoxyribose Nucleic Acid – is the information code to make an organism and controls the activities of the cell. –Mitosis copies this code so that all.

MUTATIONS. Is there such a mutant? Polymorphisms Although all polymorphisms are the result of a mutation in the gene, geneticists only refer to a change.

HW # 80- Make cookies for the Cookie Mutation Lab Warm up What are the different types of mutations? How are mutations related to evolution? Place your.

12-4 MUTATIONS. Mutations – changes in the DNA sequence that affect genetic information Gene mutations result from changes in a single gene. Chromosomal.

Changes in DNA that affect genetic information

Gene Mutations Chapter 11.

Translation The decoding of an mRNA message into a polypeptide chain (aka a protein) is the known as translation The process begins when the mRNA reaches.

BIG PICTURE: MAKING PROTEINS DNA  RNA  PROTEIN Nucleus  Cytoplasm  Ribosomes.

Genetic Mutations Muytatogns?.

8.7 Mutations TEKS 6E The student is expected to: 6E identify and illustrate changes in DNA and evaluate the significance of these changes.

GENE REGULATION Gene regulation: The ability of an organism to control which genes are transcribed in response to the environment.

Changes in DNA and Their Impacts. Analogy We will be using a sentence as an analogy representing a strand of DNA. Our sentence is: The fat cat ate the.

Section  The sequence of bases in DNA are like the letters of a coded message.  What would happen if one or a few of those letters changed accidentally,

Changes in DNA. Analogy  We will be using a sentence as an analogy representing a strand of DNA.  Our sentence is: The fat cat ate the wee rat.  If.

Genes and Gene Mutations. Gene: a sequence of DNA bases that code for a product, usually a protein. Gene mutation: a change in the sequence of bases.

MUTATIONS _______________ are changes in the genetic material. MUTATIONS mistakes REMEMBER! Mutations can happen when cells make _____________ in.

Biology Mistakes in the Genetic Machine. Terms for Section 6 Gene regulation Mutation Point mutation Frameshift mutation Mutagen.

DNA Deoxyribose Nucleic Acid – is the information code to make an organism and controls the activities of the cell. –Mitosis copies this code so that all.

Section 11.3 MUTATIONS Section 11.3 pgs

Molecular Genetics. DNA: The Genetic Material MAIN IDEA: The discovery that DNA is the genetic code involved many experiments.

MUTATIONS No this can’t happen with just mutations.

DNA Replication. Watson and Crick- discovered DNA shape Rosalind Franklin- discovered double helix.

Mutations (p. 307) Mutations are changes in the genetic material. Mutations may be genetic mutations or chromosomal mutations.

4.12 DNA and Mutations. Quick DNA Review Base pairing Base pairing.

Molecular Genetics Mutations  A permanent change that occurs in a cell’s DNA is called a mutation.  Types of mutations  Point mutation  Insertion.

Genetic Mutation. Mutation Greatest source of genetic diversity A change in the sequence of nucleotides of a gene. Some changes to the DNA will alter.

Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.

 a change in the genetic information of an organism

Gene Mutations.

Gene Mutations A change in the DNA of a gene is called a mutation. Mutations in gametes can be passed on to the offspring of the affected individual,

Gene Mutations A change in the DNA of a gene is called a mutation. Mutations in gametes can be passed on to offspring of the affected individual,

Review: Can you tell the story of protein synthesis?

Types of Mutations.

Gene Mutations Chapter 11.

Gene Mutations Essential Question: How do changes in the DNA nucleotide sequence affect the resulting protein?

Variation in Organisms

A permanent change that occurs in a cell’s DNA is called a mutation.

DNA MUTATIONS A mutation is a change in the DNA code.

Mutations: Causes and Effects

DNA: The Blueprints For Life

DNA is a double helix shape, while RNA is a single strand.

Don’t let this happen to you!!

Protein Synthesis and Mutation

GENE MUTATIONS (in DNA)

Mutations 1) Gene Mutations = change in pattern of DNA bases

Mutations: Changes in Genes

Presentation transcript:

Genetics News EditBase Mystery Sequence EditBase format Pure text format Problem Set 4

Study Question 3 What is the minimum number of bases to specify the number of different amino acids found in protein? G A C T 1 base fixed length nonoverlapping

Study Question 3 What is the minimum number of bases to specify the number of different amino acids found in protein? 2 base, fixed length, nonoverlapping

Study Question 3 What is the minimum number of bases to specify the number of different amino acids found in protein? 3 base, fixed length, nonoverlapping

Growth of E. coli on a plate

Infection by phage T4

Growth of E. coli B + phage T4 Seed plate with E.coli B and phage T4 (not visible)

Growth of E. coli B + phage T4

rII region of phage T4 rII T4 rII + T4 rII - T4 DNA rIIA rIIBrIIA - rIIB

Distinguishing T4 rII + from rII - T4 rII + T4 rII - E. coli B x T4 rII + T4 rII - E. coli K( ) x T4 rII - cannot grow on E. coli K( )

Why is T4rII - defective? T4 rII - T4 rII + E. coli K( ) No infection Lysis

Crick et al frameshift experiment rIIA - rIIA + proflavin

How to explain frameshift results? Role of proflavin in experiment CACTCGGATACACTCGGATA C A C T C G ?? G A T A GTGAGCGTGAGC GTGAGCACGTGAGCAC Proflavin causes one base insertions (or deletions)

How to explain frameshift results? Wild type rIIA rIIA + … THE FAT CAT ATE THE BIG RAT... Wld type rIIA

How to explain frameshift results? Single frameshift rIIA - THE FAT CAR TAT ETH EBI GRA … … THE FAT CAT ATE THE BIG RAT...

How to explain frameshift results? Double frameshift rIIA - … THE FAT CAR TAT ETH EBI GRA … … THE FAT CAT ATE THE BIG RAT... … THE FAT CAR TAR TET HEB IGR …

How to explain frameshift results? Triple frameshift rIIA - … THE FAT CAR TAT ETH EBI GRA … … THE FAT CAT ATE THE BIG RAT... … THE FAT CAR TAR TET HEB IGR … … THE FAT CAR TAR TOE THE BIG...

Study Question 7 When will proflavin-induced mutation suppress?

Study Question 8 Results of frameshift experiment if variable length code? This is a variable length code This is a varitable length code Variable length code with GATC?