Using mouse genetics to understand human disease Mark Daly Whitehead/Pfizer Computational Biology Fellow

What we do Genetics: the study of the inheritance of biological phenotype –Mendel recognized discrete units of inheritance –Theories rediscovered and disputed ca –Experiments on mouse coat color proved Mendel correct and generalizable to mammals –We now recognize this inheritance as being carried by variation in DNA

Why mice? Mammals, much better biological model Easy to breed, feed, and house Can acclimatize to human touch Most important: we can experiment in many ways not possible in humans What do they want with me?

Mice are close to humans

Kerstin Lindblad-Toh Whitehead/MIT Center for Genome Research

Mouse sequence reveals great similarity with the human genome Extremely high conservation: 560,000 “anchors” Mouse-Human Comparison both genomes billion bp long > 99% of genes have homologs > 95% of genome “syntenic”

Genomes are rearranged copies of each other Roughly 50% of bases change in the evolutionary time from mouse to human

Mouse sequence reveals great similarity with the human genome Extremely high conservation: 560,000 “anchors” Anchors (hundreds of bases with >90% identity) represent areas of evolutionary selection… …but only 30-40% of the highly conserved segments correspond to exons of genes!!!

What we can do Directed matings Inbred lines and crosses Knockouts Transgenics Mutagenesis Nuclear transfer Control exposure to pathogens, drugs, diet, etc. YIKES!!!

Example: diabetes related mice available from The Jackson Labs Type I diabetes (3) Type II diabetes (3) Hyperglycemic (27) Hyperinsulinemic (25) Hypoglycemic (1) Hypoinsulinemic (5) Insulin resistant (30) Impaired insulin processing (7) Impaired wound healing (13)

Inbreeding Repeated brother- sister mating leads to completely homozygous genome – no variation!

Experimental Crosses Breed two distinct inbred lines Offspring (F1) are all genetically identical – they each have one copy of each chromosome from each parent Further crosses involving F1 lead to mice with unique combinations of the two original strains

Experimental Cross

Experimental Cross: backcross F1 bred back to one of the parents Backcross (F1 x RED) offspring: 50% red-red 50% red-blue

Experimental Cross: F2 intercross One F1 bred to another F1 F2 intercross (F1xF1) offspring: 25% red-red 50% red-blue 25% blue-blue F2

Trait mapping F2

Trait mapping Blue trees = tall, Red trees = short In the F2 generation, short trees tend to carry “red” chromosomes where the height genes are located, taller trees tend to carry “blue” chromosomes QTL mapping use statistical methods to find these regions

How do we distinguish chromosomes from different strains? Polymorphic DNA markers such as Single Nucleotide Polymorphisms (SNPs) can be used to distinguish the parental origin of offspring chromosomes ATTCGACGTATTGGCACTTACAGG ATTCGATGTATTGGCACTTACAGG SNP

Example: susceptibility to Tb C3H mice extremely susceptible to Tb B6 mice resistant F1, F2 show intermediate levels of susceptibility B6 C3H Days post infection % survival

One gene location already known Previous work identified chromosome 1 as carrying a major susceptibility factor Congenic C3H animals carrying a B6 chromosome 1 segment were bred Survival Time % survival C3H B6 C3H.B6-sst1

Congenic and consomic mice Derived strains of mice in which the homozygous genome of one mouse strain has a chromosome or part of a chromosome substituted from another strain Chr 1 Chr 2 Chr 3 Chr 4 Etc. C3H B6 C3H.B6_chr1

Tb mapping cross F2 intercross: C3H.B6-sst1 - MTB- susceptible, carrying B6 chr 1 resistance B6 - MTB-resistant Trait – survival following MTB infection B6 F1 x x n = 368 F2 … C3H.B6- sst1

Results: 3 new gene locations identified!

Gene identified on chromosome bb bh hh Chi square df P value P< days post infection % survival C57Bl/6J B6-Igh6 B6-IL12-/- Chi square df P value P< Days after infection % survival BALB/cBJ BALB/c-mMT-/- Days after infection % survival Chi square df P value P< A. B. C. At the end of chr 12 – mice inheriting two C3H copies survive significantly longer than those with one or two B6 copies Mice engineered to be missing a critical component of the immune system located in this region are likewise more susceptible, validating that particular gene as involved in Tb susceptibility

Mouse History Modern “house mice” emerged from Asia into the fertile crescent as agriculture was born

Mouse history

Recent mouse history W.E. Castle C.C. Little Fancy mouse breeding - Asia, Europe (last few centuries) Retired schoolteacher Abbie Lathrop collects and breeds these mice Granby, MA – 1900 Castle, Little and others form most commonly used inbred strains from Lathrop stock (1908 on)

Mouse history

Asian musculus and European domesticus mice dominate the world but have evolved separately over ~ 1 Million years Mixing in Abbie Lathrop’s schoolhouse created all our commonly used mice from these two distinct founder groups

Genetic Background of the inbred lab mice musc domest C57BL/6 C3H DBA Avg segment size ~ 2 Mb { cast

Comparing two inbred strains – frequency of differences in 50 kb segments { <1 SNP/10 kb { ~40 SNP/10 kb

Finding the genes responsible for biomedical phenotypes C3H (susceptible) B6 (resistant) 20 Mb Traditionally: positional cloning is painful (e.g., generating thousands of mice for fine mapping, breeding congenics) – As a result, countless significant QTLs have been identified in mapping crosses but only a small handful have thusfar resulted in identification of which gene is responsible – the critical information that will advance research into prevention and treatment!

Using DNA patterns to find genes C3H (susc.) B6 (res.) Critical Region 20 Mb

Using DNA patterns to find genes C3H (susc.) B6 (res.) DBA (susc.) Critical Region 20 Mb

Example: mapping of albinism Critical region

First genomic region mapped 129S1TA*CCC*CGGTACGAGGG AKRAGTTTAATGGTACGAGGG A_JAGTTTAATGGTACGAGGG BALB_cTA*CCCGCGGTACGAGGG C3HAGTTTAATGGTACGAGGG C57B6AGTTTAATCTAGTACCCA CBAAGTTTAATCTAGTACCCA DBA2AGTTTAATCTAGTACCCA FVBAGTTTAATCTAGTACCCA IAGTTTAATGGTACGAGGG NODAGTTTAATGGTACGAGGG NZB*ACCCC*CCT*GTACCCA SJLAGTTTAATCTAGTACCCA SWRAGTTTAATCTAGTACCCA Chr (Mb)

Future Genetic Studies Pathways Expression Mapping Model Systems

Thanks to (Whitehead Institute) Claire Wade Andrew Kirby (MIT Genome Center) EJ Kulbokas Mike Zody Eric Lander Kerstin Lindblad-Toh Funding: Whitehead Institute Pfizer, Inc. National Human Genome Research Institute