Strategic Management Walter J. Ferrier
Page 2 Strategy as Process and Perspective
Page 3 1. Articulate Mission / Intent Sense of purpose, direction… In which industries does firm compete? How does firm compete? Who are customers? Who are competitors? Strategic Management Process
Page 4 2. Set Objectives & Performance Targets Financial – Achieve 10% ROE and $1.55 EPS by YE08 – Increase stock price by $ /share Strategic – Become low price leader in industry by YE09 – Enter five new country markets by YE11
Page 5 3. Develop a Strategy Strategic themes/thrusts …How to compete: – International expansion – Increase brand name and reputation – Innovate by introducing new products – Aggressive behavior against rivals in old products
Page 6 4. Implement Strategy Develop action plan at functional level –Establish European distribution center Buy warehouse facility near airport in Germany Re-tool with robotic material handling system –Create new ad campaign for 2008 Olympics Get endorsement contract with Lance Armstrong, Marylou Retton, Mia Hamm, and Michael Johnson Develop TV ad with Spike Lee –Launch new version of product Create multifunctional design team License Oracle’s newest technology Increase R&D budget by 30% –Cut prices on older version of product by 33%
Page 7 5. Evaluation and Adjustment Assess results relative to goals –Established price leadership in 2006 –Achieved only 4% ROI in 2006 Identify new opportunities / constraints –New technologies are coming –Rivals are merging Change strategy / implementation plan (as needed)
Page 8 Dropped Strategic Actions Intended Strategy Carried Out Emergent Strategic Actions Strategic Planning vs. Strategizing
Page 9 Miles & Snow Strategy Types Defenders Prospectors Analyzers Reactors (?) Competitive advantage results from a clear and direct match between the firm’s: – Mission and values The firm’s definition of itself – Approach to business-level strategy New vs. existing markets, first-mover advantage, cost vs. innovation – Characteristics and behaviors Organizational structure, corporate culture, command/control systems
Page 10 Defenders Perspective Defend current markets Narrow product domain Cautious growth strategies Emphasis on efficiency Process Intensive, systematic strategic planning Centralized control systems Leverage existing, proven technologies Performance based on efficiency
Page 11 Prospectors Perspective Open to experimentation Exploration of new markets Aware of external trends Open to growth spurts Emphasis on innovation Process Strategy driven by innovation First-mover advantage Decentralized control systems Performance based on results
Page 12 Analyzers Perspective Keenly aware of external trends Balance between exploration and exploitation Purposeful growth building on proven capabilities, ideas Process Strategy driven by competitive intelligence, analysis “Fast-second” strategic maneuvering Performance based on results
Page 13 What Makes Shareholders Rich?... Create New Wealth – Vision looks beyond current boundaries – Strategy as continuous process – New perspectives, voices, conversations – Change rules of game – Experimentation, surprise
Page 14 New Strategy Glossary – Fresh Perspective Value migration : movement of growth and profit opportunities from one industry player to another Co-evolution : by working with direct competitors, customers, and suppliers, a company can create new businesses, markets, and industries White-space opportunity : overlooked areas of growth possibilities that don't exactly match existing skills Strategic intent : corporate goal or destiny that represents a stretch for the organization, a point of view about the competitive position a company hopes to build over the coming decade
Page 15 Adidas-Reebok Merger + vs.
Page 16 + Employees 26,10024,600 U.S. Market Share 21.1%36.3% Global Market Share 25.0%33.2% Net Income $517.9 mil$1.2 bil Hot Product SmartShoe + Nelly’s shoe line L. Armstrong apparel + iPod Sport Kit Adidas-Reebok Merger
Page 17 Strategic Innovation
Page 18 Tower-building Competition Three teams build TinkerToy tower 90 seconds each attempt Tallest tower wins – Competing teams may observe/scout, plan, organize, etc.
Page 19 High Jump Innovation: Scissor Kick 1929: 6’8”
Page 20 High Jump Innovation: Forward Roll 1960: 7’1”
Page 21 High Jump Innovation: Fosbury Flop 1968-present: 7’7” to 8’ 1/2 ”
Page 22 High Jump Innovation m 2.50m 2.25m 2.00m Scissor Roll Fosbury
Page 23 High Jump Innovation ? m 2.50m 2.25m 2.00m Scissor Roll Fosbury The Ferrier Flight
Page 24 Innovation and Organic Growth Emphasis on: – Top-line revenue – Customer-centric, customer value – Internal and external social interactions – Cross-functional and cross-experiential teams – Empathetic, high EI people – Experimentation, learning – Entrepreneurial culture, boldness, audacity Value-creating strategy vs. Value-enhancing strategy
Page 25 Product 1 New Product Introduction Profit Plateau Competition Erodes Profits Product 2 Profit Product 3 Product 4 time Value-creating vs. Value-enhancing Strategy
Page 26 Apple iPod
Page 27 Product 1 New Product Introduction Profit Plateau Competition Erodes Profits Product 2 Profit Introduce iPod Mini iPod Photo BMW iPod Adaptor iPod Wireless Remote WiFi iPod Video iPod + Timex Watch iPod + Nike Shoe Value-enhancing Innovation Product 1 Product 2 Product 3 Product 4 time Windows compatible Value-creating vs. Value-enhancing Strategy Price Cut Value-creating Innovation
Page 28 Apple’s iPod Innovation Network 10 parts create 85% of the iPod’s cost GM Ford Apple Unknown Battery Pack Renesas (Japan) Display Driver Inventec (Taiwan)- Assembly, Testing Toshiba (China) – Hard Drive Broadcom (Singapore)- Multimedia Processor Toshiba-Matsushita (Japan)- Display Module iPod PortalPlayer (US) Portal Player CPU Unknown Back Enclosure Unknown Mainboard PCB DisneyTimex Digital Music Group Delta Airlines Nike Samsung (Korea) – Mobile SDRAM memory 400 additional inputs with values from $2 to fractions of a penny, with an average value of $.05 Source: Portelligent, Inc. and Linden, Kraemer & Dedrick, Alliance Network and Innovation
Page 29 Apple – alliance network in 1995Apple – alliance network from Apple Computuer High Level of VC + VE Alliance Network and Innovation
Page 30 Introducing the iPod Commode-dore…
Page 31 Innovation (good intentions)……………..……………….flop
Page 32 Unique Perspective
Page 33 How do you define the coffee industry? Leisure, Enjoyment, Social Interaction Food & Beverage Item Coffee Packaged Convenience coffee Café/restaurant drinking Fashion Caffeine Source
Page 34 How does Starbuck’s define coffee industry?
Page 35 Red vs. Blue Oceans Red Ocean StrategyBlue Ocean Strategy Compete in existing market spaceCreate uncontested market space Beat the competitionMake the competition irrelevant Exploit existing demandCreate and capture new demand Align organization towards strategic choice between low cost or differentiation Align organization towards pursuit of low cost and differentiation
Coffee’s Next Blue Ocean? Strategic Dimension 1 ? Strategic Dimension 2
Page 37 Early U.S. Auto Industry
Page 38 Blue Oceans and The Auto Industry Company / ProductNew/IncumbentIndustry Char. Ford Model-TNew EntrantUnattractive Toyota CorollaIncumbentUnattractive Chrysler MinivanIncumbentUnattractive Toyota Prius HybridIncumbentUnattractive
Page 39 Blue Oceans and Computer Industry Company/ProductNew/IncumbentIndustry Char. IBM System 360 mainframeNew EntrantAttractive Apple PC (Apple II)New EntrantAttractive Apple PC (MacIntosh)IncumbentUnattractive Compaq PortableNew EntrantUnattractive Dell Build-to-order/JITNew EntrantUnattractive
Strategic Map: PC Industry (Pre-MacIntosh) Fast/ High Capacity Low PriceHigh Price Apple II Wang IBM Slow/ Low Capacity
Strategic Map: PC Industry (Post-McIntosh; Pre-Dell) User Friendliness GUI Drop & Drag Mouse WYSIWYG Low MarginHigh Margin Wang IBM DOS-based Operating System >copy *.doc A:\ Apple MacIntosh
Strategic Map: PC Industry (After Dell Enters) High Quality & Dependability “Regular” Supply Chain Management Lenovo Adequate Quality Apple “Efficient” Supply Chain Management High Price Dell Low Price H-P
Personal Computers …what’s the next big thing? Strategic Dimension 1 ? Strategic Dimension 2
Page 44 IBM Mainframe Apple II IBM PC Apple MacIntosh Compaq Portable Tablet PC Compaq Laptop IBM Wearable PC Wearable PC
Page 45 Innovation in Shaving Razors Try the razors Compare Evaluate
What ’ s the next big thing? Strategic Dimension 1 ? Strategic Dimension 2
Page 47 Gillette: More is Better…? 12 Blade
Page 48 Razors Design features of razors and shaving performance – Do they make a difference? – Do they create [real or perceived] value? What are relevant “strategic dimensions” of razor industry? – What needs [real or perceived] do these dimensions fulfill? Strategic Dimension 1 ? Strategic Dimension 2
Page 49 MBA 606 New Restaurant Concepts
Page 50 MBA 606 New Restaurant Concepts
Page 51 MBA 606 New Restaurant Concepts
Page 52 LG Internet Refrigerator
Page 53 Airbus A380
Page 54 Segway Personal Transporter
Page 55 Tooth Tunes
Page 56 Converging Industry Advantage Palmtop Computing Entertainment Wireless Telephony
Page 57 Competitive Interaction
Hardball? Competitive Outcomes Industry Characteristics Organizational Characteristics
Page 59 Dethronement of the Leader MarketShare Wal-Mart Sears JC Penney
Page 60 Dethronement of the Leader Market Share McDonnell- Douglass Boeing Airbus
Page 61 Dethronement of the Leader Market Share (U.S.) Adidas Nike Reebok
Page 62 King of the Hill – Fizzy Beverages Market Share Other ? Coke Pepsi
Page 63 Simple Rivalry: Prisoner’s Dilemma What to say to police? Criminal 1 Criminal 2 Confess Keep Quiet Both Serve 1 Year in Jail Both Serve 5 Years in Jail #2 Serves 10 Years in jail #1 Goes Free #1 Serves 10 Years in Jail #2 Goes Free
Page 64 Three Stooges Larry, Moe, and Curley are in a 3-way duel and agree to take turns shooting each other, in that order Accuracy statistics: – Larry hits target 20% of the time – Moe hits target 80% of the time – Curley hits target 100% of the time When the duel starts, what should Larry do?
Page 65 Competitive Intelligence A systematic and ethical program for gathering information about competitors and general business trends to further your own company’s goals
Page 66 Why CI? Play the Game Differently New market opportunity New customers Develop/leverage new value chain strengths New strategies/tactics New “flow” of the game Figuring out what drives behavior Environment/industry drivers Organizational drivers Managerial drivers Playing the Game Better Focus on existing competitors/strategic position Leverage value chain strengths Incrementally improve existing strategies/tactics
Page 67 Competitor Intelligence Pyramid s z a Sources of Data Analysis of Data Recommendations
Page 68 Recommendations Analysis of Data Sources of Data Competitor Intelligence Pyramid Industry experts/analysts Industry publications Trade shows/conferences Advertisements/PR University research centers Financial Court documents/patents Suppliers/customers Newspapers/business wire Help wanted ads Reverse engineering labs
Page 69 Your Rival’s Competitive Actions September 2006 to February 2007 Contract with Spike Lee for TV ad Increase R&D budget by 30% Buy warehouse facility near airport in Germany, Re-tool with robotic material handling system License Oracle’s newest technology Cut prices on older version of product by 33% Endorsement contract with famous U.S. Olympic athletes Create multifunctional new product design team
Page 70 Recommendations Analysis of Data Sources of Data Competitor Intelligence Pyramid Value chain analysis Ratio analysis Benchmarking Cost analysis Trend analysis Personality profiling Wargaming or scenario planning Competitive behavior analysisCompetitive behavior analysis
Page 71 Recommendations Analysis of Data Sources of Data Competitor Intelligence Pyramid Track Existing Rivals Anticipate New Rivals Inform Strategy: –Identify own/competitor’s strengths/weaknesses –Early warning system –Plan of attack/retaliation
Page 72 The Cola Wars
Page 73 Coke’s Market Share MKT PRICEPRODMKTCAPSIG PROD Competitive Action Repertoire The set of competitive actions carried out in a given time period Repertoire
Page 74 Your Rival’s Competitive Actions January-July 2008 Contract with famous movie director, Spike Lee, for TV ad Increase R&D budget by 30% Buy warehouse facility near airport in Germany, Re-tool with robotic material handling system License Oracle’s newest technology Cut prices on older version of product by 33% Endorsement contract with famous U.S. Olympic athletes Create multifunctional new product design team abcde
Page 75 Competitive Dynamics Analysis Observe competitive moves Organize competitive moves –Action/response pairs –Action repertoires (year-end tallies) –Competitive attacks/sequences Measurement/Analysis of Characteristics – – Action pattern characteristics that improve: Market share Stock price Profitability
Action Pair 1 Action Pair 2 Action Pair 3 Action Pair 4 Coca-Cola Pepsi Action-Reaction “Pairs” time Action Response ProfitsProfits GrowthGrowth Mkt. ShareMkt. Share a cd e d d ac
Action “Repertoires” time Profits Growth Mkt. Share Year-End Tallies Total Actions Complexity Coca-Cola Pepsi a c e cc a ac d
a b c d e f g h Strategy and Adaptive Maneuvering Chess : Epaulette’s Mate Sicilian Defense
Sequence Applications... LANGUAGE: BOXING: DNA: qcheaTiueissesne. hsiT si a cesneueq. This is a sequence. Jab...Jab…Uppercut CAGTACATAGTACGATACGA MUSIC: COMPUTER PROGRAM: data actions2; subj = _n_; do i = 1 to max; output = matrix; end; run;
Page 80 a b c d e cabecabdecabd CokePepsi d aa b e c e b a d b cc Observed Sequence Competitive Actions Over Time
Page 81 a b c d e cabecabdecabd CokeIndustry Norm d aa b e c e b a d b cc Observed Sequence Coke Strategic Non-Conformity
Page 82 a b c d e cab e cabdecabd Pepsi d aa b e c e b a d b c c Observed Sequence Pepsi Strategic Conformity Industry Norm
Page 83 a b c d e cabecabdecabd Coke in time 1 d e b aaa d b b e c c c Coke in time 2 Observed Sequence Coke Strategic Unpredictability
Page 84 a b c d e cabecabdecabd d e aaa d b b e cc c Pepsi in time 1 Pepsi in time 2 b Observed Sequence Pepsi Strategic Predictability
Page 85 King of the Hill – Fizzy Beverages MarketShare Other ? Coke Pepsi
Page 86 “Hardball” Competition Total Actions –More actions are better Average Response Time –Faster response time is better Repertoire Complexity –Complex repertoire is better Attack [Un-]Predictability –Unpredictability is better
Page 87 Group Exercise: Coke vs. Pepsi Total Actions –Count of total actions Average Response Time –Avg. number of time units between last competitive move in Coke’s attack and Pepsi’s first competitive response, etc. Repertoire Complexity –Extent to which entire pattern/repertoire is skewed/simple vs. balanced/complex Attack [Un-]Predictability –Recognizable repetition or action combinations in the sequence of actions?
Page 88 Scoring the Fight Total Actions Faster Responses More Complex Repertoire Unpredictable Attacks Coke Pepsi Who will win?
Page 89 Implications for CI: Predict Future Behavior of Rivals Rivals’ prior behavior Patterns Tendencies Type & order of moves Proactiveness Reactiveness Drivers of Behavior Management orientation Decision-making Financial constraints Industry characteristics
Page 90 Implications for CI: Monitor Your Own Behavior Objectively measures of competitive behavior Safeguard against complacency, predictability, simplicity of your own company Keep rivals off balance / disruption / guessing What combinations of moves are effective? …which are ineffective? …smoke signals or bluffs?
Strategic Management …Questions?