DNA

Early Experiments Griffith (1928) –Used Streptococcus pneumoniae S-strain (pathogenic) R-strain (not pathogenic)

Griffith’s Experiments Transformation: Some factor was transferred from the dead S-strain bacteria to the live R-strain bacteria. The newly “transformed” R-strain was virulent in further generations. What was the “factor”?...lots of work to find out.

The Hereditary “Factor” Molecule of Inheritance. Early on – both Proteins & Nucleic Acids were candidates for encoding the genetic material. Proteins were both specific and variable. Not much was known about Nucleic Acids…until…

Hershey & Chase’s Experiments Used a Bacteriophage (“phage”) –A bacteria-infecting virus. –Viruses = Protein & Nucleic Acid. Used Escherichia coli (E. coli) Used radioactive isotopes to label Protein & DNA. –Sulfur for Protein –Phosphorous for DNA

Hershey & Chase’s Experiments

DNA from the Virus was the “factor” that infected the bacteria. DNA was the “information” molecule – the Hereditary Molecule.

Additional Data Chargaff’s Data [Adenine] = [Thymine] [Guanine] = [Cytosine] Wilkins & Franklins’ Data –X-ray diffraction

Deoxyribonucleic Acid Watson & Crick’s model: Double Helix connected by N-bases.

DNA Replication Copying the genetic material – Duplication. –Providing blueprints for future generations of cells! Suggested by its very structure!

DNA Replication Separation of the double helix – Helicase. Unzipping of the ENTIRE DNA Molecule.

DNA Replication Semiconservative Replication. Each parent strand provides a template for the addition of complimentary bases. DNA Polymerase.

DNA Replication …Resulting in two molecules, each identical to the parent, and to each other.

How does it begin? Initiation – DNA replication is initiated at specific sites – specific nucleotide base sequences along the parent DNA strand. Numerous points of initiation are established along a DNA strand. Helicase (the “unzipper”). Topoisomerase (the “reliever of pressure”). Single-strand binding proteins (SSBs) (“stabilizers”).

How does it proceed? Elongation – new nucleotides are added by DNA polymerases. Actually, addition of nucleoside triphosphates occurs.

DNA polymerase works from the 3’ to 5’ end of the parental strand of DNA. DNA polymerase adds new nucleotides to the free-floating 3’ end of the newly- forming DNA strand only. Antiparallel Elongation

The LEADING STRAND is the fork that elongates continually from 5’ to 3’. The LAGGING STRAND is the fork that must also elongate from 5’ to 3’ – but in the opposite direction!

Antiparallel Elongation The LAGGING STRAND must, therefore, elongate AWAY from the replication fork. This results in the formation of small segments of double-stranded DNA – Okazaki fragments.

DNA Ligase – responsible for connecting (ligating) the Okazaki Fragments. Antiparallel Elongation

OK, An even closer look at: Initiation PROBLEM: –DNA Polymerase can only add new nucleotides by attaching them to the 3’ end of another nucleotide. G (T)(T) (T)(T) G

SOLUTION: –A Primer is needed (segment of complimentary RNA) is attached “out of the blue”. –Primase is the enzyme responsible. –Once enough bases are in place, DNA Polymerase takes over. (by adding bases to the 3’ end NOW there) OK, An even closer look at: Initiation

In Leading Strand… –This all happens once. In Lagging Strand… –A different DNA Polymerase replaces each Primer (RNA). –Later, Ligase connects the 5’ and 3’ ends of the two Okazaki fragments. OK, An even closer look at: Initiation

Summary of DNA Replication

Proofreading Mistakes do occur. Proofreading of the newly-formed DNA is accomplished by other DNA polymerases. Can occur AFTER replication has finished. In this case – a Nuclease enzyme cuts out a segment containing the damaged DNA, which is then replaced by DNA Polymerase and Ligase.

Animation animat/molgenetics/dna-rna2.swf

DNA Replication shortens DNA DNA Polymerase can only add to the 3’ end. Once a primer is removed, nothing can be attached to the exposed 5’ end.

Telomeres Caps of non-coding DNA at the ends of Eukaryotic DNA (chromosomes). Repeating segments: TTAGGGTTAGGGTTAGGGTTAGGG

Telomeres Postpone the Protein-encoding parts of the chromosome from being eroded after successive replications. Eventually, they get shorter and shorter…which may contribute to cell senescence (no more dividing). Many proteins are responsible for keeping the cell from activating self-destruct modes.

What about “Germ” Cells? Stem cells & sex cells give rise to more and more cells (blood cells, gametes, etc.) Erosion of genetic material on these cells would be bad. TELOMERASE – enzyme responsible for maintaining Telomere length.

Assignment for Tuesday: 1 paragraph…. –What is a “Thymine Dimer”?

Thymine Dimer

VERY INTERESTING Assignment: Read about Telomeres – p Segments of Eukaryotic DNA that do not contain genes.