Chapter 10

 Explain the research of the following scientists:  Griffith: worked with pneumonia bacteria and mice to track how infection occurs. Results: Harmless bacteria that were exposed to heat-killed harmful bacteria were transformed to harmful bacteria.  Avery: Used enzymes to break down pneumonia bacteria. Results: DNA is the transforming factor that causes infection.  Hershey and Chase: Worked with bacteriophages (viruses that infect bacteria only). Results: DNA from virus is what causes viral infections.  Franklin and Wilkins: Used X-Ray diffraction to take photos of DNA.  Watson and Crick: Credited with discovering DNA double helix structure since they could analyze X-ray diffraction photos.  Chargaff: Discovered rules of base pairing. A=T, G=C

 What is the role of DNA?  The role of DNA is to store and transfer genetic information like a library.  What is a nucleotide and what are the three parts to it?  A nucleotide is a monomer of a nucleic acid (DNA and RNA). The three parts of a nucleotide are the 5-carbon sugar, phosphate group, and nitrogenous base.  What two nitrogenous bases are purines? Pyrimidines?  Purines = Adenine and Guanine  Pyrimidines = Thymine and Cytosine  What type of bonds hold DNA together and where are they located?  Hydrogen bonds: between the nitrogenous bases  Covalent bonds: between the sugar and phosphate backbone

 List the steps to DNA replication.  1. Helicase breaks the hydrogen bonds between base pairs and “unzips” DNA.  2. DNA polymerase adds new DNA nucleotides to DNA template strands.  3. DNA polymerase releases once it reaches the end of the DNA strands. Create two semi-conservative DNA strands.  What do the following enzymes do during DNA replication?  Helicase: Breaks hydrogen bonds between nitrogenous base pairs, “unzips” DNA strands.  DNA polymerase: Adds new DNA nucleotides to template strands of DNA.  Ligase: Bonds lagging strand Okazaki fragments together.

 What does semi-conservative mean?  Term used to explain that the new strands of DNA made contain half of the original strand. Half of the parent strand is conserved.  What are the three differences between DNA and RNA?  DNA has a deoxyribose sugar. RNA has a ribose sugar.  DNA is double stranded. RNA is single stranded.  DNA uses thymine. RNA used uracil.  What are the three types of RNA used during protein synthesis and explain their function?  mRNA – messenger RNA, recipe to make proteins  rRNA – ribosomal RNA, found in ribosomes  tRNA – transfer RNA, transfers amino acids to ribosomes

 What is a codon and where is it found?  A codon is a 3 letter sequence found in mRNA.  What is an anti-codon and where is it found?  An anti-codon is a 3 letter sequence found in tRNA.

 Write the mRNA strand for this DNA strand: TACGGCATGAACGTAGCTAGCACT  AUG-CCG-UAC-UUG-CAU-CGA-UCG-UGA  What are the amino acids that correspond to the mRNA strand you just made?  Met-Pro-Tyr-Leu-His-Arg-Ser-STOP

 List the steps to transcription.  Takes place in the nucleus  RNA polymerase binds to promoter, “unzips” DNA  RNA polymerase adds RNA nucleotides to the DNA template  RNA polymerase reaches the STOP codon and releases  mRNA needs to add a poly A tail and cap before going to cytoplasm  List the steps to translation.  Takes place on a ribosome in the cytoplasm  Ribosome subunits bind together, tRNA binds to START (AUG) codon  tRNA brings amino acids to the ribosomes  tRNA reaches STOP codon and releases from ribosome  Ribosome breaks down back into subunits

 What are the roles of the following proteins do during protein synthesis?  RNA polymerase: binds to promoter on DNA, “unzips” DNA, adds RNA nucleotides  Ribosomes: Protein factory found in the cytoplasm  What is the purpose of the human genome project?  Map out chromosomes to help find cures/prevention for diseases.