Mismatch Repair Deficiency Testing Kenneth J. Bloom, MD, FCAP Chief Medical Officer, Clarient, a GE Healthcare Company.

Slides:



Advertisements
Similar presentations
Colon Cancer The life time risk of developing Colon Cancer in the United States in one in sixteen. This means 144,000 new cases a year accounting for.
Advertisements

Chapter 19 Lecture Concepts of Genetics Tenth Edition Cancer and Regulation of the Cell Cycle.
Cancer: a genetic disease of inherited and somatic mutations n Gene mutations and/or genetic instability are involved in many cancers. n Viruses and environmental.
Long-Term Colorectal-Cancer Incidence and Mortality after Lower Endoscopy Supervisor: 邱宗傑 主任 Presented by 郭政裕 總醫師 NEJM, Sep 19, 2013.
Gene 210 Cancer Genomics April 29, Key events in investigating the cancer genome M R Stratton Science 2011;331:
Lynch Syndrome and Colorectal Cancer Steven G. Proshan, M.D. Annapolis Colon and Rectal Surgeons Anne Arundel Medical Center November 8,
A few thoughts on cancer and cancer family syndromes Pamela McGrann, MD. Department of Medical Genetics.
COLORECTAL BLEEDING: a multidisciplinary approach Torino, 31 marzo-1 aprile 2006 GENETIC EVALUATION Schena M, Angelini F, Bertetto O. Department of Medical.
Mismatch Repair deficient CRC: implications for clinical practice Yoland Antill Medical Oncologist Cancer Genetics.
Hereditary Colon Cancer ACP, October 2013 Steve Lanspa MD, FACP.
Lecture 22 Cancer Genetics II: Inherited Susceptibility to Cancer Stephen B. Gruber, MD, PhD November 19, 2002.
Mechanisms and Epidemiology of Colon Cancer
Familial Colorectal Cancers Francis M. Giardiello, M.D. The Johns Hopkins University.
A signal transducer and cancer Neurofibromin, ras, and cancer - utah.
Comprehensive IHC Screening for Lynch Syndrome: What You Need to Know Andrea Lewis, MS, CGC January 14, 2010.
Hereditary tumours to be aware of Gerd JACOMEN Dept. of Pathology.
Morning Report May 20, 2009 Bridger Clarke  Born in Lawrence, Massachusetts, on 4 January  Dropped out of high school at the age of fourteen.
Gene 210 Cancer Genomics May 5, Key events in investigating the cancer genome M R Stratton Science 2011;331:
Functional consequences of NLS mutations in human MLH1 Alex Dukes Dr. Andrew Buermeyer Department of Environmental & Molecular Toxicology Oregon State.
MMR & Hereditary Non-polyposis Colorectal Cancer
MSH2 and Human Nonpolyposis Colon Cancer Yael Aschner.
HNPCC and MLH1 Qi Peng Cancer Biology March 30 th, 2006.
Determining Phenotypes of Pathogenic Mismatch Repair Mutants Brett Palama Lab of Andrew Buermeyer, Ph.D. Dept. of Environmental/Molecular Toxicology.
Pathogenic Mechanisms of Cancer Causing hMLH1 Mutations Functional Relationship between DNA Mismatch Repair and Tumor Formation Eddie O’Donnell Laboratory.
Personalised Medicine in Colorectal Cancer? Mr Arfon G M T Powell MB ChB MSc MRCSEd Clinical Research Fellow in Surgery.
West Midlands Regional Genetics Laboratory
Genetics & Colorectal Cancer
Tumor Supressor Gene Non-functional TSG Mutations increasing risk of cancer “Loss of function” mutation Proto-oncogene Oncogene (Hyperactive or unregulated.
Gene Mutations.
DNA Repair and Cancer. Genome Instability Science, 26 July 2002, p. 544.
Tumor genetics Minna Thullberg
Investigating the genetic instability and expression of four DNA repair related proteins in the peripheral lymphocytes of 36 untreated lung cancer patients.
Angelina Jolie The White Coat Wonder. Rational  The purpose of our research is to enrich the Premed-A community with the knowledge of other cancers caused.
Slides last updated: June 2015 CRC: CLINICAL FEATURES.
1 MICROSATILLITE INSTABILITY IN CRC HENRY T. LYNCH, MD JANE F. LYNCH, BSN Creighton University School of Medicine Omaha, Nebraska.
 FAP - familial adenomatous polyposis  germline mutations in the APC gene (“gatekeeper”)  HNPCC - hereditary nonpolyposis colon cancer (a.k.a. Lynch.
Familial Cancer. General Principles Mutations inherited through germ cells contribute to a minority of tumours Two hits usually needed germline/somatic.
Tumour Analysis-Lynch Syndrome Dr Alan Donaldson Consultant in Clinical Genetics Bristol.
Colorectal cancer (CRC) Professor Yaron Niv Rabin Medical Center Tel Aviv University.
סרטן מעי גס אבחון מוקדם מניעה טיפול מונע ד"ר הוברט אילה מנהלת המרכז לגידולים במערכת העיכול מכון שרת הדסה עין כרם.
What are Microsatellites? D2S123 TAGGCCACACACACACACACA Unique Primer Mono, di, tri, tetra nucleotide repeats HNPCC - Expansion/contraction of nl repeats.
Bonny Blackard Biology 169 April 4, 2006
Benign Versus Malignant Tumors
MSH2 and Hereditary Nonpolyposis Colorectal Cancer By Bobby Glenn Warren III.
MLH1: Hereditary non- polyposis colon cancer (HNPCC) By: Alison Edge.
Chapter 11 Cancer Genetics. Cell responses to environmental signals.
Microsatellite Instability Predicts Improved Response to Adjuvant Therapy With Irinotecan, Fluorouracil, and Leucovorin in Stage III Colon Cancer In association.
Date of download: 5/31/2016 From: The Hereditary Nonpolyposis Colorectal Cancer Syndrome: Genetics and Clinical Implications[dhelix] Ann Intern Med. 2003;138(7):
Gastroenterological Society of Queensland Young Investigator Awards The Traditional Serrated Adenoma A Clinicopathological and Molecular Analysis Presented.
Lynch Syndrome or Hereditary Non-Polyposis Colorectal Cancer (HNPCC)
MLH1 and HNPCC March 29, 2005 Tammy Jernigan
Carcinomas with DNA Mismatch Repair Deficiency Mohammad Hossein Sanei Mohammad Hossein Sanei Department of pathology Department of pathology Isfahan university.
Gene Expression and Retinoblastoma “Cancer of the Eye”
GENETIC BIOMARKERS.
West Midlands Regional Genetics Laboratory
A Retrospective Analysis of Microsatellite Instability testing on colorectal cancer specimens in Queensland Public Hospitals Matthew Burge; Hayden Christie;
Prof. Julien Taïeb Georges Pompidou European Hospital Paris, France
What are Microsatellites?
Genetics of Cancer Lecture 7
What makes a mutant?.
Tumor Promoting Inflammation
Colorectal cancer : Three pathways
The Role of MSH2 in Hereditary Non-Polyposis Colon Cancer
Genomic and Epigenetic Instability in Colorectal Cancer Pathogenesis
BMP Receptor 1a and Juvenile Polyposis Syndrome
Microsatellite Instability in Colorectal Cancer
Colonic polyps and tumors
Molecular Pathological Classification Of Colorectal Cancer (CRC) Dr
Neoplasia lecture 7 Dr Heyam Awad FRCPath.
A, Proportion of variants detected in the MMR genes.
Presentation transcript:

Mismatch Repair Deficiency Testing Kenneth J. Bloom, MD, FCAP Chief Medical Officer, Clarient, a GE Healthcare Company

2 Mismatch Repair Deficiency Testing Webinar 4/23/2015 Colorectal Cancer 3 rd leading cancer and 2 nd leading cause of cancer death in males and females 150,000 new cases and 55,000 deaths in USA in 2006 Most CRCs are preceded by adenomas Screening (Currently - FOBT, Endoscopy) (Future - Virtual Colonoscopy, Stool DNA) Overall 60% 5 yr. survival 93% if detected early (Stage I) 8% after distant metastasis (Stage IV)

3 Mismatch Repair Deficiency Testing Webinar 4/23/2015 Norma l Micro-adenoma APC 5q21 Adenoma KRAS 12p Adenoma HGD DCC/DPC4 18q21 Carcinoma p53 17p13 Metastasis Other Kinzler-Vogelstein-Fearon Sequential steps in APC pathway At least 7 mutations After APC the order is variable

4 Mismatch Repair Deficiency Testing Webinar 4/23/2015 Pathways to CRC 3 Possible Pathways AND not linear Chromosomal Instability 50-70% MSS sporadic CRC FAP Microsatellite Instability 15% MSI sporadic CRC HNPCC APC p53 MMR MLH1 MSH2 TGFβRII, IGF2R, BAX CpG Island Methylator Phenotype (CIMP) 20-35% Tend to have BRAF mutation EXCEPT in HNPCC Tend to have KRAS mutation

5 Mismatch Repair Deficiency Testing Webinar 4/23/2015 APC Regulation of cell cycle and apoptosis Mediation of intercellular adhesion Stabilization of cytoskeleton Signal transduction Cell proliferation Chromosomal stability Cell migration APC, 5q21, tumor suppressor gene and a “gatekeeper” Chromosomal Instability Pathway

6 Mismatch Repair Deficiency Testing Webinar 4/23/2015 E-Cadherin B-Catenin complex pp APC Serine/Threonine kinase Degradation Binds to TCF (T-cell factor) which triggers transcription of genes that promote cell division Nucleus APC - B-Catenin Interaction

7 Mismatch Repair Deficiency Testing Webinar 4/23/2015 Sporadic MSS CRC The majority of CRCs (50-70% of CRC) MSS, often aneuploid (chromosomal instability) Left>right sided, M>F Common phenotype (dirty necrosis, tumor budding, no TILs) Initial APC somatic mutation Often KRAS mutation (unresponsive to Anti-EGFR therapy) Often p53 mutation (usual stage dependant prognosis)

8 Mismatch Repair Deficiency Testing Webinar 4/23/2015 HNPCC 2-4% of CRCs Phenotype mimics sporadic CRC, precursor adenoma MSI-H, often diploid Germline mutation in MMR (MSH2, MLH1) No BRAF mutation Rare or no p53 mutation Better prognosis, but poor response to 5-FU R>L Microscopic features include Tumor infiltrating lymphocytes (TIL) Crohn’s-like lymphoid reaction Poor differentiation Mucinous change

9 Mismatch Repair Deficiency Testing Webinar 4/23/2015 MSI-H Sporadic CRC 12-15% of CRCs Precursor is sessile serrated adenoma MSI-H, often diploid Methylation of MLH-1 promoter gene Often BRAF mutation Rare or no p53 mutation R>L, F>M Better prognosis, but poor response to 5-FU Microscopic phenotype is the same as HNPCC TIL, mucinous, poor differentiation No need for prophylactic colectomy or hysterectomy No response to Anti-EGFR therapy

10 Mismatch Repair Deficiency Testing Webinar 4/23/2015 CpG Island Methylator Pathway (CIMP) Pathway 20-35% cases of CRC MSS (or MSI-L) Methylation of CpG islands (includes some MHL-1, TP16 and others) Generalized increase in de novo methylation Often diploid Rare or no p53 mutation Precursor serrated adenoma Often BRAF mutation, some also have KRAS mutation Frequent family history (but no germline mutation) R>L, F>M Generally no TILs (unlike MSI-H) tumors Poor prognosis compared to MSI CRCs But responsive to 5-FU

11 Mismatch Repair Deficiency Testing Webinar 4/23/2015 Microsatellite Instability Pathway Errors in DNA occur constantly during replication Mis-Match-Repair system identifies, excises and corrects the errors “Caretaker” genes that do not initiate tumor but cause rapid progression MMR defect is identified by studying DNA microsatellites (tri and tetranucleotide repeat sequences of unknown function distributed throughout the human genome) Similar short sequences also occur within some tumor suppressor genes (TGFβRII, IGF2R, BAX), which then may become mutated

1 base pair mismatch 3 base pairs mismatch MSH2 protein is the “scout” identifying an error has occurred. Heterodimeric complex is formed with MSH6 if a single base pair mismatch MSH3 if there is a 2-8 nucleotide insertion or deletion.

1 base pair mismatch 3 base pairs mismatch MSH2/MSH6 complex repairs 1 base pair mismatch MSH2/MSH3 complex repairs 3 base pair mismatch

1 base pair mismatch 3 base pairs mismatch MLH1/PMS1 complex is recruited to excise the mismatched nucleotides

The MMR System Vilar E et al. Nat Rev Clin Onc (2010) 7: 153

Genes Affected in dMMR Hewish M et al. Nat Rev Clin Onc (2010) 7:

17 Mismatch Repair Deficiency Testing Webinar 4/23/2015 Microsatellite Instability (MSI) BAT25 Mononucleotide BAT26 Mononucleotide D5S346 Dinucleotide D2S123 Dinucleotide D17S250 Dinucleotide MSS (stable)= 0/5 MSI-L (low grade)= 1/5 MSI-H (high grade)= 2 or >/5

18 Mismatch Repair Deficiency Testing Webinar 4/23/2015 Microsatellite Instability (MSI)

19 Mismatch Repair Deficiency Testing Webinar 4/23/2015 Microsatellite Instability (MSI) Unstable Stable Unstable

20 Mismatch Repair Deficiency Testing Webinar 4/23/2015 MSH-2 Wild-type and Mutated (likely HNPCC) MLH-1 Wild-type and Mutated (can be sporadic or HNPCC) Microsatellite Instability by IHC

IHC Findings in dMMR Vilar E et al. Nat Rev Clin Onc (2010) 7: 153 ProteinInterpretationInactivated Gene Microsatellite Instability MLH1MSH2MSH6PMS2 ++++Intact MMRMSS -++-Deficient MMRMLH1MSI +--+Deficient MMRMSH2MSI ++-+Deficient MMRMSH6MSI or MSS +++-Deficient MMRPMS2MSI

22 Mismatch Repair Deficiency Testing Webinar 4/23/2015 Problems with IHC as a Surrogate Mutation involves other than MLH-1, MSH-2 Mutations which encode a nonfunctional protein Missense Frameshift Splice

23 Mismatch Repair Deficiency Testing Webinar 4/23/2015 Rarely Nonsense Mutations Can Occur Frameshift mutation Splice mutation Wahlberg et al. Cancer Research (2002) Known MLH1 germline mutation

24 Mismatch Repair Deficiency Testing Webinar 4/23/2015 Gatalica Z and Torlakovic E. Familial Cancer 2008;7:15-26 Testing for MSI

Genes Affected in dMMR Hewish M et al. Nat Rev Clin Onc (2010) 7: Affected Gene % of Lynch Syndrome Age at Presentatio n IHC FindingSensitivity of IHC Sensitivity of PCR MLH1 3245Loss of MLH1 and PMS2 92 MSH2 3945Loss of MSH2 and MSH6 93 MSH6 1456Loss of MSH PMS2 1559Loss of PMS All

26 Mismatch Repair Deficiency Testing Webinar 4/23/2015 Reasons for assessing dMMR Better classification of colon tumors Prognostic implications Predictive implications Rule out germline mutation Select patients for further testing

27 Mismatch Repair Deficiency Testing Webinar 4/23/2015 Survival Differences dMMR Ward et al. Gut (2001)

28 Mismatch Repair Deficiency Testing Webinar 4/23/2015

29 Mismatch Repair Deficiency Testing Webinar 4/23/2015 Impact of dMMR on CRC Management

30 Mismatch Repair Deficiency Testing Webinar 4/23/2015 Novel Strategy for dMMR Hewish M et al. Nat Rev Clin Onc (2010) 7:

31 Mismatch Repair Deficiency Testing Webinar 4/23/2015 Effect of 5-FU in dMMR Vilar E et al. Nat Rev Clin Onc (2010) 7: 153

32 Mismatch Repair Deficiency Testing Webinar 4/23/2015 Effect of 5FU in dMMR Hewish M et al. Nat Rev Clin Onc (2010) 7:

33 Mismatch Repair Deficiency Testing Webinar 4/23/ FU induced death in intact MMR

34 Mismatch Repair Deficiency Testing Webinar 4/23/2015 Evidence of 5-FU Resistance Cell line with methylation of MLH1 - MSI Resistant to 5FU Demethylated cell line- MSS Sensitive to 5FU MSI closely related to CIMP group, ?MGMT methylation

35 Mismatch Repair Deficiency Testing Webinar 4/23/2015

36 Mismatch Repair Deficiency Testing Webinar 4/23/2015 Effect of Irinotecan in dMMR Hewish M et al. Nat Rev Clin Onc (2010) 7:

37 Mismatch Repair Deficiency Testing Webinar 4/23/2015 “Oh, if only it were so simple.”

38 Mismatch Repair Deficiency Testing Webinar 4/23/2015 Thank You!