In the Pursuit of Optimal Sequence Trimming Parameters for EST Projects Fabiano C. Peixoto & J. Miguel Ortega LCC-CENAPAD A T G C BIOINFORMÁTICA UFMG
Noticed: BLAST results Phred 15 Too much trimming
Query: 469 TTAGGAGGATCGTTTTTAGAATCCCCTGCAACGTTACCACGGTGGATTTCACTGACTGCG 528 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1038 ttaggaggatcgtttttagaatcccctgcaacgttaccacggtggatttcactgactgcg 979 Query: 529 ACGTTCTTAACGTTGAATCCAACGTTGCTACCAgggagagcctcagtaagtgcttcatga 588 ||||||||||||||||| || |||||||||||||||||| |||||||||||||||||||| Sbjct: 978 acgttcttaacgttgaagcccacgttgctaccagggagaccctcagtaagtgcttcatga 919 Query: 589 tgcatttcgacagaattgacttcagtcgacaaaccttgcggagcaaaagtgacgaccata 648 |||||||||||||| |||||||||| |||| ||||||||||| ||||||||||||||||| Sbjct: 918 tgcatttcgacagacttgacttcagccgaccaaccttgcggaccaaaagtgacgaccata 859 Query: 649 ccaggcttgatgataccagtttcaacgc 676 |||||||||||||||||||||||||||| Sbjct: 858 ccaggcttgatgataccagtttcaacgc 831.TGAAGCTTTCAGCTTCTTTAGGAGGATCGTTTTTAGAATCCCCTGCAAC GTTACCACGGTGGATTTCACTGACTGCGACGTTCTTAACGTTGAATCCAA CGttGCTACCAgggagagcctcagtaagtgcttcatgatgcatttcgaca gaattgacttcagtcgacaaaccttgcggagcaaaagtgacgaccatacc aggcttgatgataccagtttcaacgcctcggggccaggctggcgtgaaca gggcctagcgggtccgcgggggaagggtcccggctcaatccaccaataga gcggagctaaagtgacgggggcgcca Phred 15
Experimental approach Sequences: pUC18 plasmidial vector (published sequence) Sequence reaction: Single pool - 3 plates (96 samples) MegaBACE sequencer 3 reads for each plate, esd processing reads Processing: BLAST (MegaBLAST, as in UniGene) Phred trim: a chromatogram analyzer trim_alt: trim_cutoff parameter 1% up to 25%
16%17% Trim_alt sequence BLAST gaps/missmatches (% of bases) Additional bases 3%
Conclusions trim_alt algorithm can be used with the trim_cutoff parameter up to 18%, without including miscalled bases trim_alt algorithm with the proper parameters is capable of recovering more information than the trim algorithm other trimming algorithms, such as window- based ones, may also be analyzed in the same way
Aknowledgements Sequences: Laboratório de Genética e Bioquímica Laboratório de Imunologia de Doencas Infecciosas Laboratório de Biodiversidade e Evoluçâo Molecular Marina M. Mourão, Lucila Grossi and Renata A. Ribeiro (UFMG, Rede Genoma de Minas Gerais) Computing facilities: CENAPAD-MG/CO