1 Modular Co-evolution of metabolic networks Zhao Jing.

Slides:

Advertisements

Similar presentations

Course Evaluation Form About The Course -Go more slowly (||) -More lectures (||) -Problem Sets, Class Projects (|||) -Software tools About The Instructor.

Advertisements

Scaling, renormalization and self- similarity in complex networks Chaoming Song (CCNY) Lazaros Gallos (CCNY) Shlomo Havlin (Bar-Ilan, Israel) Hernan A.

Cartography of complex networks: From organizations to the metabolism Cartography of complex networks: From organizations to the metabolism Roger Guimerà.

The Architecture of Complexity: Structure and Modularity in Cellular Networks Albert-László Barabási University of Notre Dame title.

VL Netzwerke, WS 2007/08 Edda Klipp 1 Max Planck Institute Molecular Genetics Humboldt University Berlin Theoretical Biophysics Networks in Metabolism.

UC Davis, May 18 th 2006 Introduction to Biological Networks Eivind Almaas Microbial Systems Division.

University at BuffaloThe State University of New York Young-Rae Cho Department of Computer Science and Engineering State University of New York at Buffalo.

An Introduction of Complex networks Zhao Jing

Structure, Function and Evolution of Metabolic Networks (I) Jing Zhao College of Pharmacy, Second Military Medical University Shanghai Center for Bioinformation.

A Real-life Application of Barabasi’s Scale-Free Power-Law Presentation for ENGS 112 Doug Madory Wed, 1 JUN 05 Fri, 27 MAY 05.

STRING Modeling of biological systems through cross-species data integration.

Biological Networks Feng Luo.

Comparison of Networks Across Species CS374 Presentation October 26, 2006 Chuan Sheng Foo.

Regulatory networks 10/29/07. Definition of a module Module here has broader meanings than before. A functional module is a discrete entity whose function.

Global topological properties of biological networks.

1 Protein-Protein Interaction Networks MSC Seminar in Computational Biology

1 Topology, Functionality and Evolution of Metabolic Networks Jing Zhao Shanghai Center for Bioinformation and Technology 28, September,

Graph, Search Algorithms Ka-Lok Ng Department of Bioinformatics Asia University.

1 Structure, Function and Evolution of Metabolic Networks (II) Jing Zhao College of Pharmacy, Second Military Medical University Shanghai Center for Bioinformation.

ANALYSIS OF GENETIC NETWORKS USING ATTRIBUTED GRAPH MATCHING.

Systems Biology, April 25 th 2007Thomas Skøt Jensen Technical University of Denmark Networks and Network Topology Thomas Skøt Jensen Center for Biological.

Comparative Expression Moran Yassour +=. Goal Build a multi-species gene-coexpression network Find functions of unknown genes Discover how the genes.

Interaction Networks in Biology: Interface between Physics and Biology, Shekhar C. Mande, August 24, 2009 Interaction Networks in Biology: Interface between.

Systematic Analysis of Interactome: A New Trend in Bioinformatics KOCSEA Technical Symposium 2010 Young-Rae Cho, Ph.D. Assistant Professor Department of.

Reconstruction and analysis of human liver-specific metabolic network based on CNHLPP data Jing Zhao Logistical Engineering University The 6th Chinese.

Protein-protein interactions Chapter 12. Stable complex Transient Interaction Transient Signaling Complex Rap1A – cRaf1 Interface 1310 Å 2 Stable complex:

Large-scale organization of metabolic networks Jeong et al. CS 466 Saurabh Sinha.

Functional Linkages between Proteins. Introduction Piles of Information Flakes of Knowledge AGCATCCGACTAGCATCAGCTAGCAGCAGA CTCACGATGTGACTGCATGCGTCATTATCTA.

Network Analysis and Application Yao Fu

Biological Pathways & Networks

Protein-protein interactions Courtesy of Sarah Teichmann & Jose B. Pereira-Leal MRC Laboratory of Molecular Biology, Cambridge, UK EMBL-EBI.

Three faces of metabolites: pathways, localizations and network positions Jing Zhao( 赵静） 1, Petter Holme 2,3 1 Department of Mathematics, Logistical Engineering.

Gene Regulatory Network Inference. Progress in Disease Treatment  Personalized medicine is becoming more prevalent for several kinds of cancer treatment.

Network Biology Presentation by: Ansuman sahoo 10th semester

School of Information University of Michigan SI 614 Network subgraphs (motifs) Biological networks Lecture 11 Instructor: Lada Adamic.

Clustering of protein networks: Graph theory and terminology Scale-free architecture Modularity Robustness Reading: Barabasi and Oltvai 2004, Milo et al.

Discovering the Correlation Between Evolutionary Genomics and Protein-Protein Interaction Rezaul Kabir and Brett Thompson

Optimal Network Alignment with Graphlet Degree Vectors

Topological Network Alignment Uncovers Biological Function and Phylogeny Oleksii Kuchaiev¹, Tijana Milenković¹, Vesna Memišević, Wayne Hayes, Nataša Pržulj².

1 Having genome data allows collection of other ‘omic’ datasets Systems biology takes a different perspective on the entire dataset, often from a Network.

1 Hierarchical modularity of nested bow- ties in metabolic networks Jing Zhao Shanghai Jiao Tong University Shanghai Center for Bioinformation.

Complementarity of network and sequence information in homologous proteins March, Department of Computing, Imperial College London, London, UK 2.

Scaling, renormalization and self-similarity in complex networks

Anis Karimpour-Fard ‡, Ryan T. Gill †,

Merge links between probes by Entrez Gene identifiers Genes and proteins of living organisms deploy their functions through a complex series of interactions.

Metabolic Network Inference from Multiple Types of Genomic Data Yoshihiro Yamanishi Centre de Bio-informatique, Ecole des Mines de Paris.

CSCE555 Bioinformatics Lecture 18 Network Biology: Comparison of Networks Across Species Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu.

PPI team Progress Report PPI team, IDB Lab. Sangwon Yoo, Hoyoung Jeong, Taewhi Lee Mar 2006.

An overview of Bioinformatics. Cell and Central Dogma.

Network Evolution Statistics of Networks Comparing Networks Networks in Cellular Biology A. Metabolic Pathways B. Regulatory Networks C. Signaling Pathways.

Functional and Evolutionary Attributes through Analysis of Metabolism Sophia Tsoka European Bioinformatics Institute Cambridge UK.

Genome Biology and Biotechnology The next frontier: Systems biology Prof. M. Zabeau Department of Plant Systems Biology Flanders Interuniversity Institute.

LECTURE 2 1.Complex Network Models 2.Properties of Protein-Protein Interaction Networks.

DNAmRNAProtein Small molecules Environment Regulatory RNA How a cell is wired The dynamics of such interactions emerge as cellular processes and functions.

GO based data analysis Iowa State Workshop 11 June 2009.

Network resilience.

3-D Structural Analysis of Protein Interaction Networks Gives New Insight Into Protein Function, Network Topology and Evolution CSB Seminar Philip M. Kim,

Extracting information from complex networks From the metabolism to collaboration networks Roger Guimerà Department of Chemical and Biological Engineering.

Discovering functional interaction patterns in Protein-Protein Interactions Networks   Authors: Mehmet E Turnalp Tolga Can Presented By: Sandeep Kumar.

Robustness, clustering & evolutionary conservation Stefan Wuchty Center of Network Research Department of Physics University of Notre Dame title.

1 Lesson 12 Networks / Systems Biology. 2 Systems biology  Not only understanding components! 1.System structures: the network of gene interactions and.

Algorithms and Computational Biology Lab, Department of Computer Science and & Information Engineering, National Taiwan University, Taiwan Network Biology.

Comparative Network Analysis BMI/CS 776 Spring 2013 Colin Dewey

Change in Pufs and their RNA InteractionsAnalogous change in transcription factors and their gene regulation Puf binding specificity tends to be conserved.

Graph clustering to detect network modules

1. SELECTION OF THE KEY GENE SET 2. BIOLOGICAL NETWORK SELECTION

Assessing Hierarchical Modularity in Protein Interaction Networks

Biological Networks Analysis Degree Distribution and Network Motifs

Building and Analyzing Genome-Wide Gene Disruption Networks

Modelling Structure and Function in Complex Networks

Presentation transcript:

1 Modular Co-evolution of metabolic networks Zhao Jing

2 Background Background Results/Discussion Topological modules and their functions The similarity between the phylogenetic profiles of enzymes within modules Determining the evolutionary ages of modules Evolutionary rates of enzyme genes in modules Comparison the Humo sapien network with its random counterparts Conclusion Outline

3 Background Life’s complex Pyramid Oltvai, Z.N., Barabási, A.-L., Life’s Complexity Pyramid, SCIENCE, 2002, 298:

4 Functional modules: protein complexes, signalling/metabolic pathways and transcriptional clusters Evolutionary modules: cohesive evolutionary blocks in cellular systems Network topological modules Different aspects of modules:

5 Functional modules => evolutionary modules Snel B, Huynen MA: Quantifying Modularity in the Evolution of Biomolecular Systems. Genome Res : Work functional modules in total

6 Phylogenic profiles

7 Campillos M, von Mering C, Jensen LJ, Bork P: Identification and analysis of evolutionarily cohesive functional modules in protein networks. Genome Research 2006, 16: Evolutionary age Work 2

8 Evolutionary rate CheChen Y, Dokholyan NV: The coordinated evolution of yeast proteins is constrained by functional modularity Trends in Genetics 2006, 22(8): Work 3

9 Evolutionary modules => functional modules von Mering C, Zdobnov EM, Tsoka S, Ciccare FD, Pereira-Leal JB, Ouzounis CA, Bork P: Genome evolution reveals biochemical networks and functional modules. PNAS 2003, 100: Network: E.coli PPI network predicted by STRING ; each node is a COG Modules: topological modules got by network clustering Reference functional modules: 144 e.coli metabolic pathways from EcoCyc Result: 74% of the known metabolic enzymes clustering together in modules Work 1

10 Yamada T, Kanehisa M, Goto S: Extraction of phylogenetic network modules from the metabolic network. BMC Bioinformatics 2006, 7(1):130. Yamada T, Goto S, Kanehisa M: Extraction of Phylogenetic Network Modules from Prokayrote Metabolic Pathways. Genome Informatics 2004, 15: Network: enzyme graph including all the organisms in KEGG Work 2

11

12 Topological modules = > functional modules Guimera R, Nunes Amaral LA: Functional cartography of complex metabolic networks. Nature 2005, 433(7028):

13 Zhao J, Yu H, Luo J, Cao Z, Li Y: Hierarchical modularity of nested bow-ties in metabolic networks. BMC Bioinformatics 2006:7:386.

14 Fraser H, Hirsh A, Steinmetz L, Scharfe C, Feldman M: Evolutionary Rate in the Protein Interaction Network. Science 2002, 296: Work 1 How network topology affect protein evolution?

15 Work 2 Vitkup D, Kharchenko P, Wagner A: Influence of metabolic network structure and function on enzyme evolution. Genome Biology 2006, 7(5):R39.

16 Work 3 Light S, Kraulis P, Elofsson A: Preferential attachment in the evolution of metabolic networks. BMC Bioinformatics 2005, 6:159. The average connectivity for enzymes in phylogenetic groups 1–5

17 Work 4 Fraser H: Modularity and evolutionary constraint on proteins. Nature Genetics 2005, 37(4): Protein interaction hubs situated within modules are more evolutionarily constrained(have lower mean evolutionary rate)than those bridging different modules.

18 My question: Topological modules => Evolutionary modules?

19 Identifying topological modules and their functions Core-periphery organization of modules Table 1

20 The similarity between the phylogenetic profiles of enzymes within modules

21 Spearman’s rank correlation is r= , P-value is 0.059

22 Totally 12 of the 25 modules (module 7,3,25,9,16,4,6,22,12,15,19,21) were found to be evolutionary modules, most of which are periphery modules.

23 The evolutionary ages of modules We classified enzymes in the Homo sapiens network into seven evolutionary ages: (1) Prokaryota; (2) Protists; (3) Fungi;( 4) Nematodes;(5) Arthropods;(6) Mammalian and (7) Human Table 2

24 Evolutionary rates of enzyme genes in modules Spearman’s rank correlation is r= , P-value=

25 Comparison the Humo sapien network with its random counterparts (1) topological null model Z-score=19

26 (2) biological null model

27

28 Conclusions From Topology: metabolic networks exhibit highly modular core-periphery organization pattern. From Function: The core modules perform housekeeping functions, the periphery modules accomplish relatively specific functions. From Evolution: The core modules are more evolutionarily conserved, the periphery modules appear later in evolution history. => The core-periphery modularity organization reflects the functional and evolutionary requirement of metabolic system.

29 Thanks!