MICROBES Grand Challenge in Comparative Endocrinology.

Slides:



Advertisements
Similar presentations
Pre-SIG meeting " Genome Annotation" A BioSapiens initiative Goal of the workshop were - to create an open forum to discuss current problems on function.
Advertisements

Program Goals: to create a new type of organization - a cyberinfrastructure collaborative for plant science - that will enable new conceptual advances.
The Drug Discovery Process
Martin John Bishop UK HGMP Resource Centre Hinxton Cambridge CB10 1 SB
Ontology annotation: mapping genomic regions biological function Paul D Thomas, Huaiyu Mi and Suzanna Lewis.
Biology and Bioinformatics Gabor T. Marth Department of Biology, Boston College BI820 – Seminar in Quantitative and Computational Problems.
Computational Molecular Biology (Spring’03) Chitta Baral Professor of Computer Science & Engg.
Bioinformatics: a Multidisciplinary Challenge Ron Y. Pinter Dept. of Computer Science Technion March 12, 2003.
BI420 – Course information Web site: Instructor: Gabor Marth Teaching.
NSF on the web- An indispensable resource
Signaling Pathways and Summary June 30, 2005 Signaling lecture Course summary Tomorrow Next Week Friday, 7/8/05 Morning presentation of writing assignments.
Molecular Library and Imaging Francis Collins, NHGRI Tom Insel, NIMH Rod Pettigrew, NIBIB Building Blocks and Pathways Francis Collins,NHGRI Richard Hodes,
The NIH Roadmap for Medical Research
Bioinformatics Ayesha M. Khan Spring Phylogenetic software PHYLIP l 2.
Overview of Bioinformatics A/P Shoba Ranganathan Justin Choo National University of Singapore A Tutorial on Bioinformatics.
GGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTAC CCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGG
9/30/2004TCSS588A Isabelle Bichindaritz1 Introduction to Bioinformatics.
The BIO Directorate Microbial Biology Emphasis BIO Advisory Committee April, 2005.
Paper in “Evolution and Development” The Evolution of Signaling Pathways In Animal Development Andr é Pires-daSilva & Ralf J. Sommer Nature Reviews Genetics,
Erice 2008 Introduction to PDB Workshop From Molecules to Medicine: Integrating Crystallography in Drug Discovery Erice, 29 May - 8 June Peter Rose
Genome-scale Metabolic Reconstruction and Modeling of Microbial Life Aaron Best, Biology Matthew DeJongh, Computer Science Nathan Tintle, Mathematics Hope.
Overall Goal Support integrative research in organismal biology at the frontier.
歐亞書局 PRINCIPLES OF BIOCHEMISTRY Chapter 9 DNA-Based Information Technologies.
Shankar Subramaniam University of California at San Diego Data to Biology.
Modelling, comparison, and analysis of proteomes Ram Samudrala University of Washington.
Problem Statement and Motivation Key Achievements and Future Goals Technical Approach Investigators: Yang Dai Prime Grant Support: NSF High-throughput.
Sequence Databases What are they and why do we need them.
Genome Project and Bioinformatics Dr Tan Tin Wee Director Bioinformatics Centre.
Chapter 13. The Impact of Genomics on Antimicrobial Drug Discovery and Toxicology CBBL - Young-sik Sohn-
CS 790 – Bioinformatics Introduction and overview.
Gene Regulatory Network Inference. Progress in Disease Treatment  Personalized medicine is becoming more prevalent for several kinds of cancer treatment.
University of Texas, El Paso April 7-8, 2005 What About Graduate School? Opportunities in Endocrinology Kenneth L. Campbell Professor of Biology University.
Transgenic and Evolution By Emily Norovsambuu. What is transgenic? If a gene or genes that have been transferred from a different species to unlike species.
Gary Stormo by Andrew Bardee. History Born 1950 in South Dakota Undergraduate in Biology from Caltech PhD in Molecular Biology from University of Colorado.
Expanding Biomedical Research in Maine Mount Desert Island Biological Laboratory Patricia H. Hand, Ph.D. Administrative Director.
Computational biology of cancer cell pathways Modelling of cancer cell function and response to therapy.
Integrating the Bioinformatic Technology Group into your research programme Introduction People and Skills Examples Integrating the BTG Contacts BHRC Away.
1970s Functional Genetics From … Functional Genomics … to … Evolution of.
Biological Signal Detection for Protein Function Prediction Investigators: Yang Dai Prime Grant Support: NSF Problem Statement and Motivation Technical.
Bioinformatics The application of computer technology to the management of biological information
Consortium for Interdisciplinary Studies on Science for Aging.
Researchers use genetic engineering to manipulate DNA. Section 2: DNA Technology K What I Know W What I Want to Find Out L What I Learned.
EB3233 Bioinformatics Introduction to Bioinformatics.
KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
Pathogenomics How this project began: Ann Rose - take advantage of DNA sequence information - genomics Julian Davies - use the information to understand.
Biotechnology and Genomics Chapter 16. Biotechnology and Genomics 2Outline DNA Cloning  Recombinant DNA Technology ­Restriction Enzyme ­DNA Ligase 
Bioinformatic Investigation of Insulin Signalling System.
Bioinformatics Research Overview Li Liao Develop new algorithms and (statistical) learning methods > Capable of incorporating domain knowledge > Effective,
Biotechnology and Bioinformatics: Bioinformatics Essential Idea: Bioinformatics is the use of computers to analyze sequence data in biological research.
Effect of Alcohol on Brain Development NormalFetal Alcohol Syndrome.
Using DNA Subway in the Classroom Genome Annotation: Red Line.
What is Biotechnology? How Long have humans used Biotechnology?
The National Science Foundation Independent Federal Agency Support for all fields of fundamental science and engineering.
BNFO 615 Fall 2016 Usman Roshan NJIT. Outline Machine learning for bioinformatics – Basic machine learning algorithms – Applications to bioinformatics.
Biotechnology.
High-throughput data used in bioinformatics
Introduction and Definitions
Outline of Discussion Defining Health Promoters
Action: BM0806 Recent Advances in Histamine Receptor H4R Research
Molecular Docking Profacgen. The interactions between proteins and other molecules play important roles in various biological processes, including gene.
New genes can be added to an organism’s DNA.
Genomes and Their Evolution
Genome organization and Bioinformatics
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
9 Future Challenges for Bioinformatics
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Introduction to Bioinformatic
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Presentation transcript:

MICROBES Grand Challenge in Comparative Endocrinology

GPCR Models Bioinformatics, genomics Molecular Comparative Endocrinology Molecular Comparative Endocrinology Comparative Genomes Structure-Activity Relationships Identifying and Mapping New Comparative Genomes: Novel Receptors can be identified from where they are annotated as to their sequence and their percent identity Use of gene prediction models; Phylogenetic analysis Receptors of interest can be cloned, expressed and tested for function Compare to newly sequenced genomes Identifying and Mapping New Comparative Genomes: Novel Receptors can be identified from where they are annotated as to their sequence and their percent identity Use of gene prediction models; Phylogenetic analysis Receptors of interest can be cloned, expressed and tested for function Compare to newly sequenced genomes Frontiers in Comparative Endocrinology

GPCR Models Bioinformatics Molecular Biology Medical & Therapeutic Development Structure-Activity Relationships MOLECULAR COMPARATIVE ENDOCRINOLOGY: Site-directed mutagenesis Pharmacological Studies Identify binding sites Determine activation, binding sites and signaling pathways Propose new ligand molecules MOLECULAR COMPARATIVE ENDOCRINOLOGY: Site-directed mutagenesis Pharmacological Studies Identify binding sites Determine activation, binding sites and signaling pathways Propose new ligand molecules Example: NOVEL RECEPTORS ARE IDENTIFIED

Comparative Endocinology Basic, Applied and Therapeutic/Medical Models Discovery of Novel Hormones and Signaling pathways; Discovery of New Pharmaceuticals to treat human disease; Hormonally based strategies for pest control; Development of “Endocrinomics”—high through put analysis Discovery of Novel Hormones and Signaling pathways; Discovery of New Pharmaceuticals to treat human disease; Hormonally based strategies for pest control; Development of “Endocrinomics”—high through put analysis Support New Key/alternate model organisms in evolution; Mechanisms of Evolution via genome discoveries Research Cooperative Networks Support New Key/alternate model organisms in evolution; Mechanisms of Evolution via genome discoveries Research Cooperative Networks Highlight Cutting Edge Discoveries Implementation of Grand Challenges in Comparative Endocrinology Dissemination of Information to public; scientists Comparative Endocrinology

North American Society for Comparative Endocrinology (NASCE) Purpose: To promote the study of hormones, hormone action in diverse animal species; to foster interdisciplinary collaborations; to promote the development of databases and other research tools for comparative endocrinology; to advocate for funding for comparative endocrinology research The NASCE will become incorporated as a nonprofit organization in the spring of A website is under development and a solicitation for charter membership will be sent out at this time. The society will include scientists from Canada, the USA and Mexico. Co-chairs of the organizing committee: Bob Denver, Univ. of Michigan, USA Vance Trudeau, University of Ottawa, Canada Meetings of the NASCE will be held once every two years in the summer, to alternate with meetings of the European Society of Comparative Endocrinologists.

Comparative Endocinology Neuroendocrine System Developmental, Physiology Behavior Developmental, Physiology Behavior Organismal Form, Function, Survival Organismal Form, Function, Survival Interactions with the Environment Frontiers in Comparative Endocrinology CLIMATE CHANGE Comparative Endocrinology