The Blueprint of Life, From DNA to Protein Chapter 7

Preview How does the genetic information pass on to the next generation? How is the information stored in DNA being used to make protein? How are the protein expression regulated?

The Blueprint of Life Characteristics of each cell dictated by information contained on DNA –DNA holds master blueprint All cell structures and processes directed by DNA

Review of DNA basics 5’ end (phosphate) 3’ end (hydroxyl) Two H bonds Three H bonds Double-stranded Double helix Sugar-phosphate backbone Strands are complementary Base-pairing rules: A-T G-C Strands are anti-parallel Composed of deoxyribonucleotides Covalently bonded in chains

N N N N N 5’ 3’ N N N N N 5’ 3’ If there are 400 cytosines in a DNA molecule that has 1000 base-pairs, how many adenines does the molecule have? C C G G A A A T T T question

Figure 7.1

DNA Replication

Semi-conservative Orig. New Orig.

DNA Replication Synthesis is 5’  3’ (note: polymerase reads template 3’  5’) Semi-conservative Bi-directional DNA polymerase “reads” template, adds proper nucleotide to the 3’ end of the new chain Second round of replication can start before first is complete DNA polymerases generally corrects errors during replication (“proofreading”) Error rate = 1/billion nucleotides DNA polymerases require a primer ( they can only add nucleotides onto an existing chain )

question If a primer were available that bound to the center of the template molecule in the diagram below, which way would DNA polymerase move during DNA synthesis?

A G T C T G C C T A T C G T G A C T A 5’ 3’ T C A G A C G G A T A G C A C T G A T 5’ 3’ 5’ 3’ 5’ question

A G T C T G C C T A T C G T G A C T A 5’ 3’ T C A G A C G G A T A G C A C T G A T 5’ 3’ 5’ question 5’ 3’ 5’

A G T C T G C C T A T C G T G A C T A 5’ 3’ T C A G A C G G A T A G C A C T G A T 5’ 3’ 5’ question 5’ 3’ 5’

A G T C T G C C T A T C G T G A C T A 5’ 3’ T C A G A C G G A T A G C A C T G A T 5’ 3’ 5’ question 5’ 3’ 5’

A G T C T G C C T A T C G T G A C T A 5’ 3’ T C A G A C G G A T A G C A C T G A T 5’ 3’ 5’ question 5’ 3’ 5’

A G T C T G C C T A T C G T G A C T A 5’ 3’ T C A G A C G G A T A G C A C T G A T 5’ 3’ 5’ and so on… question 5’ 3’ 5’

DNA Replication Replication is initiated at a single distinct region (origin of replication = ori) *Depicts only a small segment of the circular chromosome 5’ 3’ 5’

DNA Replication 5’ 3’ 5’ Replication is initiated at a single distinct region (origin of replication = ori) A short stretch of RNA (complementary to DNA) is synthesized

DNA Replication 5’ 3’ 5’ Replication is initiated at a single distinct region (origin of replication = ori)

DNA Replication 5’ 3’ 5’ The replication fork (details are shown in Figure 7.6, which is optional) Leading strand - continuous synthesis Lagging strand - discontinuous synthesis (Okazaki fragments) DNA ligase Replication is initiated at a single distinct region (origin of replication = ori)

DNA Replication Semi-conservative Bi-directional Second round of replication can start before first is complete

DNA Replication

Gene expression

DNA to Proteins - General Principles M I C R O B I O L O G Y ATGCCCGTAGATGGCCCTGAGCGACCGGACCCTGATGCC met pro val asp gly pro glu arg pro asp pro asp ala Morse code: Distinct series of dots and dashes encode the 26 letters of the alphabet Letters strung together make words  sentences  stories DNA: Distinct series (triplets) of the four nucleotides encode the 20 amino acids Amino acids strung together make proteins (structural and functional)  cells  organisms

Gene Expression - Overview Coded by DNA: Protein A Protein B Protein C Protein D Protein E Protein F Protein G Protein H Protein I RNA transcripts: Protein D Protein molecules D D D D D D D D D D D D D D D D D D D D D D D D D D D D D D D D D Transcription Translation Gene: functional unit of DNA that contains information to produce a specific product

Gene Expression - Overview Coded by DNA: Protein A Protein B Protein C Protein D Protein E Protein F Protein G Protein H Protein I RNA transcripts: Transcription Messenger (mRNA) Ribosomal RNA (rRNA) Transfer RNA (tRNA) rRNA tRNA Three functional types of RNA: Translation Protein molecules

Review of RNA basics Composed of ribonucleotides (ribose not deoxyribose); uracil replaces thymine Characteristics of RNA OH

Characteristics of RNA Composed of ribonucleotides (ribose not deoxyribose); uracil replaces thymine Characteristics of RNA Single-stranded Sequence is “identical” to a stretch of one strand of DNA; complementary to the other

Composed of ribonucleotides (ribose not deoxyribose); uracil replaces thymine Characteristics of RNA Single-stranded Sequence is “identical” to a stretch of one strand of DNA; complementary to the other RNA

Composed of ribonucleotides (ribose not deoxyribose); uracil replaces thymine Characteristics of RNA Single-stranded Sequence is “identical” to a stretch of one strand of DNA; complementary to the other Template strand RNA Note: always read (and write) a DNA (or RNA) sequence in the 5’ to 3’ direction, or specify otherwise

Bacterial Gene Expression - Transcription Transcription initiates at a promoter (sequence “theme” recognized by RNA polymerase) Transcription stops at a terminator 5’ TTGACA 3’ 3’ AACTGT 5’

Bacterial Gene Expression - Transcription Terms to note: Monocistronic Polycistronic (prokaryotes only) Upstream Downstream Initiation - RNA polymerase binds to promoter (guided by sigma factor) Elongation - RNA polymerase synthesizes RNA in 5’  3’ (no primer needed) Termination -

Bacterial Gene Expression - Transcription 5’ A T G A T C T G A G T A T G C G C T 3’ 3’ T A C T A G A C T C A T A C G C G A 5’

Bacterial Gene Expression - Transcription 5’ A T G A T C T G A G T A T G C G C T 3’ 3’ U A C U A G A C U C A U A C G C G U 5’ 5’ A U G A U C U G A G U A U G C G C U 3’ 3’ T A C T A G A C T C A T A C G C G A 5’ 5’ TTGACA 3’ 3’ ’ 5’ ’ 3’ ACAGTT 5’

Prokaryotic Gene Expression - Transcription

Bacterial Gene Expression - Translation Ribosomes “read” mRNA; facilitate conversion of the encoded information into proteins Message is read in triplets (codons) AGAAUGCCCAAUGCGUUACGAUGCCC

Bacterial Gene Expression - Translation Ribosomes “read” mRNA; facilitate conversion of the encoded information into proteins Message is read in triplets (codons) AGAAUGCCCAAUGCGUUACGAUGCCC

Bacterial Gene Expression - Translation Ribosomes “read” mRNA; facilitate conversion of the encoded information into proteins Message is read in triplets (codons) But where should the ribosome start “reading”??? Genetic code is degenerate AGAAUGCCCAAUGCGUUACGAUGCCC

Bacterial Gene Expression - Translation But where should the ribosome start “reading”??? Prokaryotes (monocistronic and polycistronic messages) - translation begins at first AUG after a ribosome- binding site Ribosomes “read” mRNA; facilitate conversion of the encoded information into proteins Eukaryotes (moncistronic messages only) - translation begins at first AUG Message is read in triplets (codons) Genetic code is degenerate AGAAUGCCCAAUGCGUUACGAUGCCC

Bacterial Gene Expression - Translation Proper reading frame is critical AGAAUGCCCAAUGCGUUACGAUGCCC AUG

Bacterial Gene Expression - Translation Proper reading frame is critical AGAAUGCCCAAUGCGUUACGAUGCCC

Bacterial Gene Expression - Translation tRNAs are the “keys” that decipher the code Each tRNA carries a specific amino acid Each tRNA has a specific anticodon, complementary to a codon, that binds mRNA

Bacterial Gene Expression - Translation translocation elongation factors Initiation Elongation 5’ E P A

Bacterial Gene Expression - Translation Termination

Bacterial Gene Expression - Translation

Eukaryotic Gene Expression

Prokaryotic Gene Expression

Eukaryotic Gene Expression

Prokaryotic Gene Expression

Eukaryotic Gene Expression

AAAAAAAAAA

Regulation of Gene Expression Microorganisms regulate its gene expression to adapt environment change –Controls metabolic pathways Two general mechanism –Allosteric inhibition of enzymes –Controlling synthesis of enzymes »Directed at making only what is required

Prokaryotic Gene Regulation Coded by DNA: Protein A Protein B Protein C Protein D Protein E Protein F Protein G Protein H Protein I RNA transcripts: Protein D Protein molecules D D D D D D D D D D D D D D D D D D D D D D D D D D D D D D D D D Transcription Translation rRNA tRNA

Prokaryotic Gene Regulation Constitutive enzymes Inducible enzymes Repressible enzymes Always produced Genes turned “on” only when needed Genes turned “off” when not needed

Mechanisms controlling transcription –Often controlled by regulatory region near promoter Protein binds to region and acts as “on/off” switch –Binding protein can act as repressor or activator »Repressor blocks transcription »Activator facilitates transcription Regulation of Gene Expression

Repressors –inhibits gene expression and decreases the synthesis of enzymes –usually in response to the overabundance of an end product –Repressors block the ability of RNA polymerase to bind and initiate protein synthesis –Corepressor –inducer

Regulation of Gene Expression Activators –turns on the transcription of a gene or set of genes Inducer Enzymes synthesized in the presence of inducers are called inducible enzymes

Regulation of Gene Expression Operon model of gene expression –a set of genes that are controlled by regulatory proteins –divided into two regions, the control region and the structural region The control region include the operator and the promoter –The operator acts as the “on-off” switch The structural region includes the structural genes –This region contains the genes being transcribed

Operon structure Promoter – Binding site for RNA polymerase Operator – binding site for the repressor protein for the regulation of gene expression Structural Genes – DNA sequence for specific proteins Operator Gene 1Gene 3Gene 2 Promoter

Prokaryotic Gene Regulation DNA-binding proteins repressor binds, blocking transcription activator binds, facilitating transcription (negative control) (positive control) Activity of activators/repressors can be controlled

Lac operon  -galactosidase transport Lactose  glucose + galactose

Lac operon  -galactosidase transport Turned “on” only when lactose is present AND glucose levels are low Is lactose present? If no, repress Is glucose present? If yes, don’t activate Lactose  glucose + galactose

Lac operon Turned “on” only when lactose is present AND glucose levels are low Glucose transport into cell lowers cAMP levels Negative control - repressor is active if lactose is absent; inactive if lactose is present Positive control - CAP only binds if cAMP is available (glucose levels are low)